Computational protocol: Effects of Genotype and Child Abuse on DNA Methylation and Gene Expression at the Serotonin Transporter

Similar protocols

Protocol publication

[…] A detailed description of the methods and procedures used in the Iowa Adoption Study (IAS) has been previously published (Philibert, ). All procedures used in the IAS were approved by the University of Iowa Institutional Review Board.The clinical data and biomaterial for the current studies were drawn from a set of 152 subjects examined previously in whom we have demonstrated GxE effects. In brief, the childhood abuse data is derived from Wave 4 of the IAS (1999–2004) during which were asked about a range of current symptoms and past childhood events. To assess familial childhood sex abuse, subjects were asked two questions. The first question was; “Before you were age 16, where there any sexual contact between you and any family member, like a parent or stepparent, grandparents, uncle, aunt, brother, sister, or cousin? By sexual contact I mean their touching your sexual parts, your touching their sexual parts, or sexual intercourse.” The second question was; “Was there sexual contact with a parent or grandparent?” The answers to these questions were combined to form the sex abuse variable. For the purposes of this study, and affirmative answer to either question was deemed a positive response. To assess for the presence of non-familial childhood sexual abuse, the subjects were asked an identically phrased question with the exception that “anyone other than a family member” was substituted for the text referring to family members in the two questions. Similarly, any affirmative response to either of these questions was deemed a positive response.DNA and RNA for the current studies were prepared as previously described from EBV transformed lymphoblast cell lines (Philibert et al., ). Genotyping of the 5HTTLPR variant was conducted as previously described.The study attempted to measure the expression of three separate SLC6A4 spliced Exon 1 containing variants that include either (1) both Exon 1A and B (1A + 1B), (2) just Exon 1A or (3) just Exon 1C, immediately upstream of exon 2. We have already produced a probe specific to the first variant 1A + 1B; (Philibert et al., ). Because was not possible to devise a Taqman Probe to assess the presence of the second variant which contains just exon 1A upstream of exon two (1A + 2), therefore, we assessed its presence using both conventional and Sybr green mediated PCR-based techniques. The reverse and forward primers were CCAGCCCGGGACCAGCCTCCCCGCGCAGCC and CCGAGCTCTCTATCGTCGGGATTGACACGTCGGGATTGA, respectively. The forward primer was situated on exon 2 and the reverse primer was situated on exon 1A. RTPCR was performed using the POWER SYBR Green Master Mix (ABI, Foster City, CA, USA) and two above primers and an annealing temperature of 70°C using a7900HT Fast Real-Time PCR System (ABI, Foster City, CA, USA). A third variant, which includes exon 1C, was assessed using the reverse primer for exon 2 listed above and a forward primer unique to exon 1C AGCCTCCACGGCGGTGAAATGAAG.In order to determine the expression of total and (1A + 1B) SLC6A4 mRNA, total RNA was reverse transcribed to cDNA using an Applied Biosystems cDNA archiving kit (ABI, Foster City, CA, USA). Quantification of each 5HTTLPR variant was conducted with Taqman probe sets and amplification reagents from Applied Biosystems (Foster City, USA) using a Fluidigm BioMark Genetic Analysis System (South San Francisco, USA). The sequence of the 5HTT specific primer probe sets which bridge exons 1A and 1B (ABI, Hs00984354) and exons 8 and 9 (ABI, Hs00169010) have been described previously (Philibert et al., ). The comparator housekeeping gene probe sets were for the following genes: CALR, RPL7A, RPS19, RPS 20, and UBC. After a brief pre-amplification procedure, RTPCR quantification of transcript levels was performed in triplicates in two separate runs (9216 reactions per run) on Biomark Fluidigm platform using default settings. CT counts were determined using proprietary Fluidigm software with the results being exported for analysis.The SLC6A4 methylation values at 16 individual CpG residues for the subjects were extracted from a data set constructed for genome wide DNA methylation studies. In brief, methylation status at SLC6A4 and other loci were assessed using the Illumina HumanMethylation450 BeadChip under contract by the University of Minnesota Genome Center using the protocol specified by the manufacturer and the contractor using a random assignment paradigm. The resulting microarray data were inspected for complete bisulfite conversion of the DNA and the presence of chip or batch variation with no significant results after the average beta values (i.e., average methylation) for each CpG residue were determined using the GenomeStudio V2009.2; Methylation module Version 1.5.5., version 3.2 (Illumina, San Diego). The HumanMethylation450 BeadChip contains 485,577 probes that recognize at least 20,216 unique features. With respect to this sample, >99.76% of the 485,577 probes yielded statistically reliable data. The resulting beta values were then exported from the larger data set into Microsoft Excel (Microsoft, USA) for data management prior to data analysis.Prior to analysis, all gene expression and methylation data were converted to z-scores with all data analysis being performed using the JMP version 9 (SAS Institute, Cary, SC, USA) and SPSS version 19 (IBM, New York).In order to identify functional loci for which methylation was associated with expression of different transcripts, regression analyses were conducted for each of the 16 methylation loci. We examined the effect of genotype and methylation jointly, controlling for the effect of level of alternate transcript. We first examined the association of methylation with transcription of Exon 1A + 1B controlling for transcription of Exon 8, and then examined transcription of Exon 8, controlling for transcription of Exon 1A + 1B. Following identification of functional regions with regard to each transcript, we then examined the role of sex abuse and genotype on methylation at functional loci. Regression of methylation level on sex abuse and genotype was conducted for each of the functional loci. […]

Pipeline specifications

Software tools Fluidigm software, GenomeStudio
Application dPCR
Organisms Homo sapiens
Chemicals Serotonin