Computational protocol: Structural Analysis and Deletion Mutagenesis Define Regions of QUIVER/SLEEPLESS that Are Responsible for Interactions with Shaker-Type Potassium Channels and Nicotinic Acetylcholine Receptors

Similar protocols

Protocol publication

[…] SSS loop deletions were generated by QuikChange PCR mutagenesis of untagged SSS/pcDNA and SSS-MYC/pcDNA [] using the following primers:ΔL1 F: 5’ CGCGATCGATTTACTGCTATGCGGCCGCTACCTGCAACGGTTGCTGCGT 3’ΔL1 R: 5’ ACGCAGCAACCGTTGCAGGTAGCGGCCGCATAGCAGTAAATCGATCGCG 3’ΔL1K1 F: 5’ TGCTATGAGTGCGACGCGGCCGCTCGCTGCAAGGATCCT 3’ΔL1K1 R: 5’ AGGATCCTTGCAGCGAGCGGCCGCGTCGCACTCATAGCA 3’ΔL1K2 F: 5’5’ GATGCCCGCTGCAAGTTGATGACCTGCAAC 3’ΔL1K2 R: 5’ GTTGCAGGTCATCAACTTGCAGCGGGCATC 3’ΔL2 F: 5’ AACGGTTGCTGCGTGGCGGCCGCTATGTGTACGTCACAG 3’ΔL2 R: 5’ CTGTGACGTACACATAGCGGCCGCCACGCAGCAACCGTT 3’ΔL3 (untagged) F: 5’ TGGTCGATCACGTGTGCATGGCGGCCGCTTTTTGTGAGGAAGATATGTGC 3’ΔL3 (untagged) R: 5’ GCACATATCTTCCTCACAAAAAGCGGCCGCCATGCACACGTGATCGACCA 3’ΔL3 (MYC tagged) F: 5’ TGGTCGATCACGTGTGCATGGCGGCCGCTTTTTGTGAGGAAGATATCGAGC 3’ΔL3 (MYC tagged) R: 5’ GCTCGATATCTTCCTCACAAAAAGCGGCCGCCATGCACACGTGATCGACCA 3’De novo structural models were generated by submitting the FASTA sequences through Robetta Full-chain Protein Structure Prediction at http://robetta.bakerlab.org/. Robetta models were visualized using the free software PyMol (www.pymol.org). Sequence analysis for prediction of signal peptide and post-translational modifications were performed using algorithms found at http://www.cbs.dtu.dk/services/SignalP/, http://www.imtech.res.in/raghava/glycoep/submit.html, and http://mendel.imp.ac.at/gpi/gpi_server.html. HA-tagged α4 was generated as previously described []. HA-tagged Dα3 and GFP-tagged Shaker were generated as previously described []. […]

Pipeline specifications

Software tools Robetta, PyMOL, SignalP
Application Protein structure analysis
Organisms Drosophila melanogaster
Diseases Neurotoxicity Syndromes
Chemicals Acetylcholine, Potassium