Computational protocol: Expression of ayu antimicrobial peptide genes after LPSstimulation

Similar protocols

Protocol publication

[…] The sequence of the AMPs from ayu was obtained based on information stored at Gene Bank (U.S.A.). cDNA sequence database accession number of cathelicidin, hepcidin and β-actin (actb) was FR667573.1, AB020884.1 and AB020884.1, respectively. The Primer-Blast was used to design the primers included the Primer3Plus software (http://www.bioinforrmatics.nl/ogibin/primer3plus/primer3plus-cgi), and the primer sequences were checked with a Blast search. The primer sequences were: cathelicidin forward primer, ATGAATTCGGAAGTATTGTCGTGCAAC; cathelicidin reverse primer, ATGAATTCCTCCTCCTCATCCTTATCTTT; hepcidin forward primer, AGCAGCTATGCTTTGCCCTA; hepcidin reverse primer, GCACCAACGACACAGAGAGA; actb forward primer, CCGACTACCTGATGAAGATCCTGACAGAG; and actb reverse primer, GGTGGTCTCGTGAATACCGCAAGACTC. The ayu housekeeping gene encoding β-actin (actb) was also amplified to assess the quality of the cDNA and to normalize the expression of the genes. Twenty-five µl of the PCR reactions contained Ex Taq® DNA Polymerase (Takara Biotechnology), 1 µl of template cDNA and 0.64 µl of the forward and reverse primers. The PCR products were isolated with gel electrophoresis on 2% agarose gel (Agrose LO3; Takara Biotechnology), stained with ethidium bromide, and visualized with a UV transilluminator (UVP BioDoc-It Imaging System, Upland, CA, U.S.A.). The PCR cycle number was 35. It is the optimum cycle number in the logarithmic phase. […]

Pipeline specifications

Software tools Primer-BLAST, Primer3
Application qPCR
Organisms Plecoglossus altivelis, Tetraodon lineatus