Pipeline publication

[…] b'formed for 16 h at 5.2 V/cm with 0.5\xe2\x80\x9340 s switch time, determined the size and quality of DNA inserts. Size markers Lambda Ladder PFG Marker (New England BioLabs, Ipswich, MA) and GeneRuler\xe2\x84\xa2 1 kb Plus (Fermentas Waltham, MA, USA) were used., BAC-ends were sequenced on an ABI PRISM 3130 XL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using pIndigoBAC5 sequencing primers: 5\xe2\x80\xb2 end (BAC5) CTCGTATGTTGTGTGGAATTGTGAGC and 3\xe2\x80\xb2 end (BAC3) GGATGTGCTGCAAGGCGATTAAGTTGG. The BAC-end sequences (BESs) obtained using the BAC3 and BAC5 primers were given the \xe2\x80\x9c_3\xe2\x80\x9d and \xe2\x80\x9c_5\xe2\x80\x9d suffixes, respectively., The bioinformatic analysis of BESs included a nucleotide similarity search of homologous sequences. RepeatMasker (http://www.repeatmasker.org) was first used to annotate and mask repeat sequences. To identify homologous coding sequences, BESs were compared to sequences deposited in NCBI gene databases using blast2go (Conesa et al., ) and BLASTN 2.2.26 +/BLASTX 2.2.26 + algorithms., Each BAC was digested by two different restriction enzymes, HindIII and Eco130I, using 2 units of enzyme for 1 \xce\xbcg of clone DNA. The reaction was performed at 37\xc2\xb0C for 16 h. Electrophoresis of digested products was performed in 1% agarose gels (Sigma, USA), at 0.09 kV for 20 h. Image 3.10b (Sulston et al., ) and FPC V8.5.3 (Soderlund et al., ) software were used to construct the contigs, with a tolerance value of 3 and a cut-off of 1e-10., Products amplified using LangCHIL primers from BAC insert DNA were sequenced, and obtained sequences were compared with the probe sequence. Sequencing of two selected BAC clones was performed using chromosome walking, with new p' […]

Pipeline specifications

Software tools RepeatMasker, Blast2GO, BLASTN, BLASTX
Chemicals Heterocyclic Compounds, 2-Ring, Pyrans, Glycine