Similar protocols

Pipeline publication

[…] f the Cre iPCR primers are (5΄ to 3΄): 2291_CRE1_F GGAGTTTCAATACCGGAGAT; 2292_CRE1_R AGGGTGTTATAAGCAATCCC; 2299_CRE2_F AGTTTCAATACCGGAGATCA; 2300_CRE2_R TTTCGGCTATACGTAACAGG., After ligation, the DNA was purified, and eight 25-μl PCR reactions, each containing 100 ng template, were pooled for sequencing. Illumina NexteraXT NGS library preparations were performed according to manufacturer's protocols. We performed sequencing of TLA libraries on the Illumina MiSeq platform pooling ∼20 libraries per V2 PE150 sequencing run yielding on average 1 million reads per library., Because the TLA protocol leads to reshuffling of genomic sequences, reads were mapped using split-read aware alignment with BWA mapping software version 0.6.1-r104, settings: bwasw –b 7 (). Although we perform paired-end sequencing, we do not use the paired-end information in the mapping owing to reshuffling of the sequence. Paired ends are therefore treated separately in the general analysis. The data were aligned to the human (hg19), mouse (mm9) and rat (rn5) genome. The resulting BAM files were analyzed using IGV software ()., For all seven lines, the mice were first typed for presence or absense of the Cre transgene using the generic Cre_Apob primers and probes listed in . Using the same primers and probes, samples were then analyzed in triplicate or quadruplicate and Cq values for the samples and the internal reference (Apob) were calculated using CFX Manager software (Bio-Rad). The means of the Cq values were used to calculate ΔCq values and these were then used to calculate transgene copy number using the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$2^{-{\Delta\Delta}{\rm C_q}}$\end{document} formula (). Genomic DNA was isolated from tail biopsies using the Agencourt DNAdvance kit, 96 well (Beckman Coulter) and tail DNA from a homozygous knock-in Cre line (two copies of Cre) was used as copy-number reference. Based on transgene integration site […]

Pipeline specifications

Software tools BWA, IGV, CFX Manager