Computational protocol: Panmixia and dispersal from the Mediterranean Basin to Macaronesian Islands of a macrolichen species

Similar protocols

Protocol publication

[…] Small pieces (0.5 cm2) of terminal lobes of freshly collected thalli or recent herbarium specimens were used for DNA isolation with the DNeasy Plant Minikit (Qiagen, Hilden, Germany).We genotyped each specimen at eight fungus-specific microsatellite markers (Pcar1–8). Details of the markers, PCR conditions and multiplexing are given in ref. . Fragment lengths were determined on a 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Electropherograms were analyzed with Geneious7.1.9 using LIZ-500 as internal size standard. Missing data were ignored in all subsequent analyses except the analysis of population genetic structure (see below, DAPC). For the analysis of population genetic structure, missing data were replaced with the mean frequency of the corresponding allele computed on the whole set of individuals to avoid adding artefactual between-group differentiation. [...] For designing P. carporrhizans-specific MAT-genes primers we obtained partial MAT1-1 and MAT1-2 sequences from the scaffolds of the P. carporrhizans genome via blastx using as query mating-type sequences of Xanthoria elegans, Xanthoria polycarpa, and Lobaria pulmonaria. Primers were designed with Primer 3 Plus. The newly designed MAT1-1 primers (Alpha-F: GATCAGCCTCGTTCAACCAT, Alpha-R: TAGTGTGCAGGCTCGATGAC) amplified a 389-bp fragment around the alpha-box of the MAT1-1 gene. The MAT1-2 primers (HMG-F: AAGAAGACAAGGTCGCTCGT, HMG-R:CTTGCGAGGCTGGTACTGAT) amplified a 282-bp fragment around the HMG-box of the MAT1-2 gene.To identify the mating-type idiomorph of each sample, we performed multiplexed PCR reactions in a total volume of 25 μL with 0.65 μL of each MAT1-1 primer (10 μM), 0.6 μL of each MAT1-2 primer (10 μM), 0.4 μL dNTP’s (10 mM; Biotools B&M Labs, Madrid, Spain) and 0.5 μL DNA polymerase (1 U/μL, Biotools B&M Labs, Madrid, Spain) and 2.5 μL of 10–50 ng DNA. PCR reactions were performed with an initial denaturalization at 94 °C for 4 min, followed by 10 cycles of denaturalization step at 95 °C for 10 sec, annealing at 55 to 50 °C for 20 sec and extension at 72 °C for 30 sec, followed by 30 additional cycles with annealing temperature of 50 °C for 20 sec and an additional extension at 72 °C for 5 min. We tested if both idiomorphs were evenly distributed in the entire area and in each individual sampling locality with χ2 tests. [...] Within-population genetic diversity was calculated by estimating allelic richness and private allelic richness using a rarefaction approach, implemented in ADZE. We also calculated Nei’s unbiased haploid diversity (uh) using GenAlEx version 6.41.To analyze the level of linkage disequilibrium we estimated rBarD (unbiased index of association) within populations and among loci with the function poppr of the R package poppr v.2.1.1. This index detects signatures of multilocus linkage, indicating association between alleles at different loci and clonal reproduction within populations. Significant departure from the null model of no linkage among markers was tested using 999 permutations at a significance level of 0.05.To quantify genetic differentiation among and within populations we carried out a global analysis of molecular variance (AMOVA) as a weighted average over loci using Arlequin v3.5. Significance was obtained via a non-parametric permutation procedure (20,000 permutations). Additionally, pairwise genetic differences between populations (FST) were calculated using Arlequin v3.5. [...] To detect population structure we used the multivariate, model-free method DAPC (Discriminant Analysis of Principal Components). We chose to use this method because, contrary to a STRUCTURE-like approach, it is not based on the assumption of unlinked markers and panmictic populations, which are highly unlikely in clonal or partially clonal organism, such as lichens. Clustering on individuals was performed using the R package adegenet 2.0.1. […]

Pipeline specifications

Software tools Geneious, BLASTX, Biotools, GenAlEx, Arlequin, adegenet
Application Population genetic analysis
Organisms Fungi