Computational protocol: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis

Similar protocols

Protocol publication

[…] CD1d−/− and CD1dfl/flCD11cCre mice were co‐housed with WT littermates until weaning (3 weeks) and then isolated into individual autoclaved cages. Two consecutives litters from the same breeding pair were used. Samples were collected 3–4 weeks after weaning for intestinal microbiota analysis. The intestinal content of the distal 3 cm of the small intestine (ileum), excluding 1 cm proximal to the caecum, was obtained by manual extrusion. This ileum portion was then flushed with cold PBS and opened longitudinally. The inner surface (ileum wall) was scraped with a scalpel and washed with PBS. For oral αGalCer experiments, fresh stool pellets were collected before and 10 days after αGalCer administration. Samples were stored at −80°C until processing.Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. The numbers of intestinal bacteria were determined by qPCR using SYBR Green Master kit (Bio‐Rad) and the following primers: Eubacteria‐F: 5′‐ACTCCTACGGGAGGCAGCAGT‐3′; and Eubacteria‐R 5′‐ATTACCGCGGCTGCTGGC‐3′. For the standard curve, DNA from Pseudomonas denitrificans isolated from stool of a C57BL/6 mouse was amplified using the primers mentioned above and cloned into a TOPO vector (TOPO TA Cloning Kit for Sequencing; Invitrogen).Sequencing of the V1–V3 region of the 16S rRNA gene was performed at MR DNA (www.mrdnalab.com, Shallowater, TX, USA) using the Illumina MiSeq sequencing platform. 16S rRNA sequences were processed with Mothur as we have previously described with some minor modifications (Schloss et al, ; Isaac et al, ). Briefly, sequences shorter than 500 bp that contained homopolymers longer than 8 bp with undetermined bases or with a quality average score < 30 were not included in the analysis. Sequences were aligned to the 16S rRNA gene using the SILVA reference alignment as a template. Potential chimeric sequences were removed using chimera.uchime program. To minimize the effect of pyrosequencing errors in overestimating microbial diversity (Huse et al, ), rare abundance sequences that differ in up to four nucleotides from a high abundant sequence were merged to the high abundant sequence using the pre.cluster option in Mothur. Since different numbers of sequences per sample could lead to a different diversity (i.e. more OTUs could be obtained in those samples with higher coverage), we rarefied all samples to the number of sequences obtained in the sample with the lowest number of sequences (i.e. 3,094 sequences), with the exception of the experiment shown in Fig E–G and in which 20,000 sequences per sample were utilized.OTUs were identified using the average‐neighbour algorithm. Sequences with distance‐based similarity of 97% or higher were grouped into the same OTU. Each sequence was classified using the Bayesian classifier algorithm with a bootstrap cut‐off of 60% (Wang et al, ). Classification was assigned to the genus level when possible; otherwise, the closest level of classification to the genus level was given, preceded by “unclassified”. In order to compare the overall microbiota similarity in the relative abundance of the OTUs present in different intestinal samples (Fig A and E, and ), the Yue–Clayton distance was calculated for every pair of samples. Subsequently, principal coordinates analysis was performed on the resulting matrix of distances between each pair of samples using Mothur.Two‐tailed Wilcoxon non‐parametric test was applied to identify significant microbiota taxonomic differences among groups of mice. The FDR approach was applied to adjust for multiple hypothesis testing (Benjamini et al, ). Very low abundant taxa and OTUs (< 10 counts in the two groups of samples under comparison) were not included in the statistical analysis. Changes with a P < 0.05 and FDR < 0.25 were considered significant. […]

Pipeline specifications

Software tools mothur, UCHIME
Application 16S rRNA-seq analysis
Organisms Bacteria, Mus musculus