Dataset features

Specifications


Application: Gene expression microarray analysis
Number of samples: 39
Release date: Dec 1 2017
Last update date: Aug 23 2018
Access: Public
Diseases: Leukemia, Leukemia, Hairy Cell, Neoplasms
Dataset link Comprehensive analysis of genomic G-quadruplex forming oligonucleotides homologous to NHEIII1 of c-MYC promoter on leukemia cell growth inhibition and c-MYC expression

Experimental Protocol


A total of 39 samples were hybridized, representing triplicates with untreated (unt) at 0h, 24h, 48h, and 72h, and three (3) oligonucleotide treatments: Pu27, Pu9-, and Pu5- at three (3) timepoints: 24h, 48h, and 72h (3+3x3x4=39). This includes: Untreated (wild type) at 0, 24, 48, and 72 hr; Treated with the Pu5- oligonucleotide sequence TGGGGAGGGTGGGGAGGGTGGTGAGGGTGGGGAGGGGGAAGG at 24, 48, and 72hr; Treated with the Pu9- oligonucleotide sequence GGGTGGGGAGGGTGGGGAAG at 24, 48, and 72hr; and Treated with the Pu27 oligonucleotide sequence TGGGGAGGGTGGGGAGGGTGGGGAAGG at 24, 48, and 72hr. The complete data matrix including control probes (49,495 data rows) is included as a Series supplementary file.

Repositories


GEO

GSE63016

BioProject

PRJNA266430

Download


Contact


Eric Rouchka