Computational protocol: Toxin production in a rare and genetically remote cluster of strains of the Bacillus cereus group

Similar protocols

Protocol publication

[…] The positions of coding sequences were predicted using EasyGene []. The following genomic sequences were used as reference strains: B. cereus ATCC 14579 [GenBank:AE016877], B. cereus ATCC 10987 [GenBank:AE017194], B. cereus G9241 [GenBank:AAEK01000000], B. cereus E33L [GenBank:CP000001], B. thuringiensis serovar konkukian str. 97–27 [GenBank:AE017355], B. thuringiensis serovar israelensis ATCC 35646 [GenBank:AAJM01000000], and B. weihenstephanensis KBAB4 [GenBank:AAOY00000000]. Pairwise alignments were calculated using the Smith-Waterman algorithm [].MLST was performed using partial sequences of the genes adk, ccpA, glpF, glpT, panC, pta, and pycA, ranging in length from 330 to 444 nucleotides, according to the scheme given at the University of Oslo's Bacillus cereus group MultiLocus Sequence Typing website []. PCR and DNA sequencing was performed as described, with the exception that primer aagtaagggctaagaaga was used as the forward primer for amplification of glpT, and primers ccaagggatataaagcgagatg and aatcaactataccgtttgtatttgc was used for panC. The GenBank accessions for the sequences from NVH 883/00 are adk; [GenBank:EF108377], ccpA; [GenBank:EF108378], glpF; [GenBank:EF108379], glpT; [GenBank:EF108380], panC; [GenBank:EF108381], pta; [GenBank:EF108382], and pycA; [GenBank:EF108383]. The GenBank accessions for the sequences from INRA AF2 are adk; [GenBank:EF108384], ccpA; [GenBank:EF108385], glpF; [GenBank:EF108386], glpT; [GenBank:EF108387], panC; [GenBank:EF108388], pta; [GenBank:EF108389], and pycA; [GenBank:EF108390]. The sequences for strain NVH 391/98 were obtained from the NVH 391/98 shotgun genome sequence [GenBank:AALL00000000], except in case of the adk locus, for which the sequence was obtained in the current report [GenBank:EF108391]. The reference strains listed above were used for all loci, with the exception of glpF, which was absent from the available shotgun genome sequences of B. weihenstephaniensis KBAB4 and B. thuringiensis serovar israelensis ATCC 35646, and tuncated in B. cereus G9241. The DNA sequences of all seven genes were concatenated, giving a sequence 2700 nucleotides in length, and aligned using ClustalW. A phylogenetic tree was calculated using the neighbour-joining method, where genetic distances were estimated using the Kimura model and bootstrap confidence values were generated using 1000 permutations. The tree was printed using TreeView []. […]

Pipeline specifications

Software tools EasyGene, Clustal W, TreeViewX
Applications Genome annotation, Phylogenetics
Organisms Bacillus cereus
Diseases Enteritis, Foodborne Diseases