Computational protocol: Potential of biosynthesized silver nanoparticles using Stenotrophomonas sp. BHU-S7 (MTCC 5978) for management of soil-borne and foliar phytopathogens

Similar protocols

Protocol publication

[…] The bacterial strain BHU-S7 was identified using 16S rDNA sequence analysis using universal primer pair, forward (5′AGAGTTTGATCCTGGCTCAG3′) and reverse (5′AAGGAGGTGATCCAGCCGCA 3′). The analysis of partial 16S rDNA sequence was done using BLAST program at National Center for Biotechnology Information (NCBI). The closely related sequences were selected and aligned using Clustal X and further phylogenetic tree was constructed by neighbor-joining method using MEGA 6.0 software. […]

Pipeline specifications

Software tools Clustal W, MEGA
Application 16S rRNA-seq analysis
Organisms Bacteria, Cicer arietinum
Chemicals Hydrogen Peroxide, Silver