Computational protocol: Isolation and genetic characterization of Japanese encephalitis virus from equines in India

Similar protocols

Protocol publication

[…] The synthetic oligonucleotides used for sequencing of 2,500 nuceleotides of JEV genome were: forward primer ATCAATATGCTGAAACGCGGTC and reverse primer TTCCTTGTGCGCTTTGTGGACGA. Viral RNA from JEV-infected PS cells was reverse-transcribed using reverse primer and Stratascript reverse transcriptase. cDNA copies were generated by PCR using Dream Taq PCR mix (Fermentas, Germany). The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. Positive transformants were selected by colony PCR with the above mentioned primers and restriction enzyme digestion of recombinant plasmid with EcoRI. Double-stranded DNA sequencing of the recombinant clone was performed by primer-walking at the National Facility for DNA Sequencing, University of Delhi South Campus, India and Sequence Analyzer 3730 (Applied Biosystems, USA).Nucleotide sequence of the equine JEV isolate JEV/eq/India/H225/2009 (accession No. HQ018880) was analyzed using the BLAST database (NCBI, USA). The nucleotide sequences were aligned using ClustalW and a phylogenetic tree generated by the maximum parsimony method using MEGA 4.0 software []. Statistical analysis of the tree was performed by bootstrap re-sampling (1,000 data sets) of the multiple alignments. […]

Pipeline specifications

Software tools Clustal W, MEGA
Application Phylogenetics
Organisms Equus caballus, Japanese encephalitis virus, Homo sapiens
Diseases Encephalitis, Infection, Nervous System Diseases, Virus Diseases
Chemicals Nucleotides