Computational protocol: Frequent Occurrence of Tomato Leaf Curl New Delhi Virus in Cotton Leaf Curl Disease Affected Cotton in Pakistan

Similar protocols

Protocol publication

[…] Rolling circle amplification (RCA) using phi 29 DNA polymerase (ThermoFisher Scientific, Waltham, MA USA) was used to amplify all circular DNA molecules in 31cotton samples []. The DNA-A and DNA-B components of ToLCNDV were amplified by polymerase chain reaction (PCR)with RCA-enriched nucleic acid samples as the template and using the specific primer pairsToLCNDV_A1_Forward (GATATCATCATTTCAACGCCCGCATCGAA)/ToLCNDV_A2_Reverse (GATATCTGCTGGTCGCTTCGCCATAGTTC), ToLCNDV_A3_Forward (GAGCTCGTGCAGTTGTCCCCATTGCCCGCGTCAC)/ToLCNDV_A4_Reverse(GAGCTCCATAGGGGCTGTCGAAGTTG) for DNA-A and ToLCNDV_B1_Forward (AAGCTTCTGCTCGAACATGGACGGAAATGAC)/ToLCNDV_B2_Reverse (AAGCTTAGCCAGTTGAGGAATAGATGCATG), ToLCNDV_B3_Forward (GGTACCCGTAACGATCTTGAACTATGTCCC)/ToLCNDV_B4_Reverse (GGTACCCTATCTGGCTATAGGTCCGAACG) for DNA-B. The degenerate primers BegomoF and BegomoR were used to PCR amplify the genomes of monopartite and/or DNA-A components of bipartite begomoviruses []. Betasatellites and alphasatellites were PCR-amplified using universal primers [, ]. The primers described by Shuja et al. [] were used to specifically detect CLCuKoV.PCR reactions for cloning used RCA product as the template. Amplification products of ~2.8 kb, for virus, DNA-A or DNA-B, and ~1.4 kb for alphasatellite and betasatellite, were cloned into a T/A cloning vector (pTZ57R/T; ThermoFisher Scientific, Waltham, MA USA). From each isolate 3–5 clones were sequenced. Sequences were determined by dideoxy nucleotide chain termination sequencing on an Applied Biosystems 3730XL DNA sequencer and were assembled and manipulated using the Lasergene package of sequence analysis software (DNAStar Inc., Madison, WI, USA). The MUSCLE option of the Sequence Demarcation Tool [] was used to analyze the sequenced clones for the identification of distinct geminivirus species according to revised taxonomy of begomoviruses based on pairwise sequence comparisons []. Sequences were aligned using CLUSTAL W [] implemented in MEGA6 []. Phylogenetic analyses were conducted on aligned sequences using the neighbor-joining and bootstrap options of CLUSTAL X and visualized in TreeView []. […]

Pipeline specifications

Software tools SDT, Clustal W, MEGA, TreeViewX
Application Phylogenetics
Organisms Tomato leaf curl New Delhi virus, Gossypium hirsutum, Human poliovirus 1 Mahoney, Cotton leaf curl Kokhran virus, Tomato leaf curl virus, Viruses
Diseases Duodenal Ulcer