Similar protocols

Protocol publication

[…] Paraneotermes simplex was collected Sept. 15, 2002 in Secret Woods County Park, Ft. Lauderdale, Florida, (lat. 26.08567, long. −80.18017) and deposited in the University of Florida termite collection, accession number FL1563. Reticulitermes virginicus was collected on Feb 21, 2005 at the same location and deposited in the University of Florida termite collection, accession number FL2261. Cryptotermes cylindroceps, Calcaritermes nearcticus, and Heterotermes tenuis were collected as reported previously , . No specific permits were required for the described field studies, the locations are not privately owned or protected, and no endangered or protected species were collected.DNA barcodes at the mitochondrial 16S (LSU) rRNA marker for P. simplex and R. virginicus were amplified using LR-N-13398 CGCCTGTTTATCAAAAACAT and LR-J-13007 TTACGCTGTTATCCCTAA under conditions previously described , . Since no comparable P. simplex barcode was available, we also barcoded P. simplex from eight other independent isolations (University of Florida Termite collection accessions FL2476, FL1793, PR348, BA2814, BZ87, GUA615, HN24, and HN700) from Florida, Puerto Rico, Bahamas, Belize, Guatemala, and Honduras (the latter three being new regional and country records for this species). These new barcodes were submitted to GenBank under accessions KC140183-90. These were aligned with all available Paraneotermes and Reticulitermes mt LSU termite barcodes from Genbank using MAFFT , and refined by eye using SeaView . Poorly aligned regions were automatically removed with trimAl using a gap threshold of 0.9 . AIC weight as calculated with the perl script MrAIC.pl was used to determine the evolutionary model that best fit the data, which corresponded to GTR+Γ+I in all cases. For the termite phylogeny, Maximum Likelihood (ML) estimation was carried out using PhyML 3.0 with statistical support inferred from 1000 bootstrap replicates. [...] Target cells were isolated by micropipette using a Zeiss Axiovert 2 microscope and each isolated cell was photographed using a QImaging MicroImager II camera (data not shown). DNA was isolated using the Epicentre Masterpure Complete DNA and RNA purification Kit (Madison, WI). SSU rRNA gene sequences were amplified from single cells, small pools of identical cells, and whole hindgut contents using eukaryote-specific primers 5′-TGC GCT ACC TGG TTG ATC CTG CC-3′ and 5′-TGA TCC TTC TGC AGG TTC ACC TAC-3′ as described previously , . PCR products were separated by agarose gel electrophoresis, cloned using the StrataClone PCR Cloning Kit (Stratagene, Mississauga, ON), and sequenced on both strands using BigDye Terminator v 3.1. For each new taxon, a representative SSU rRNA gene either identical to or closest to the consensus was chosen to represent the species in phylogenetic analyses and submission to GenBank.Parabasalian and host rRNA phylogenies were inferred using ML and Bayesian tree reconstruction methods, with PHyML v.3 and MrBayes v.3.2 , respectively. The evolutionary model that best fit the data was determined with mrAIC.pl (Nylander, J. A. A. 2004. MrAIC.pl. Program distributed by the author. Evolutionary Biology Centre, Uppsala University), and corresponded to GTR+Γ+I in both cases. For PHyML, eight rate categories were used with the gamma shape parameter and the proportion of invariable sites estimated from the data. The SPR method of tree improvement was chosen, and 1000 bootstrap replicates performed for evaluating the support. For MrBayes, the inference used four Metropolis-coupled Markov Chain Monte Carlo consisting of 1,000,000 generations with sampling every 100 generations. The average standard deviation of split frequencies was used to assess the convergence of the two runs. Bayesian posterior probabilities were calculated from the majority rule consensus of the tree sampled after the initial burnin period corresponding to 20% of the generations (200,000 generations). […]

Pipeline specifications

Software tools MAFFT, SeaView, trimAl, PhyML, MrBayes
Organisms Nitrosomonas sp., Reticulitermes virginicus
Diseases Precursor Cell Lymphoblastic Leukemia-Lymphoma