Computational protocol: A Closer Look on the Polyhydroxybutyrate- (PHB-) Negative Phenotype of Ralstonia eutropha PHB-4

Similar protocols

Protocol publication

[…] Isolation of genomic DNA of R. eutropha was done according to Marmur . Plasmid DNA was isolated by the method of Birnboim and Doly . DNA manipulations and other standard molecular biology techniques were performed according to Sambrook et al. . Amplifications of genomic DNA were made using Herculase II Fusion DNA polymerase (Agilent Technologies) in an Omnigene HBTR3CM DNA thermocycler (Hybaid) employing oligonucleotide primers mentioned below. Obtained sequences were analyzed using Chromas software (version 1.45, Technelysium Pty Ltd), Genamics Expression software (version 1.100 [http://genamics.com/expression/index.htm]), BLAST online service available on NCBI (National Center for Biotechnology Information [http://blast.ncbi.nlm.nih.gov/Blast.cgi]), and BioEdit . Competent cells of E. coli were prepared and transformed by the CaCl2 procedure as described by Hanahan . [...] For sequencing the genomic region of R. eutropha PHB-4 from 886 bp upstream of gene phaC to 123 bp downstream of gene phaB comprising the whole phaCAB operon, a 4860 bp DNA fragment was generated by PCR using Herculase II Fusion DNA Polymerase (Agilent Technologies) and primers phaCAB_fw: GCCGATGAACAGGTCGCGGTTGCC and phaCAB_rv: GCCTTGACGGCCCGCGAAACGG applying genomic DNA of mutant R. eutropha PHB-4 as template. The purified PCR product (peqGOLD Gel Extraction Kit, peqlab) was ligated with vector pJET1.2/blunt and applied for transformation of competent E. coli TOP10 cells according to the CloneJET PCR Cloning Kit (Thermo Scientific). Recombinant plasmids were isolated from positive E. coli clones, and three independently obtained plasmids were subjected to DNA sequence analysis using the sequencing primers listed in in order to generate overlapping sequences to ensure sufficient coverage.DNA sequencing was carried out at the Sequence Laboratories Göttingen (Seqlab). Obtained sequences were assembled and analysed using Chromas software (version 1.45, Technelysium Pty Ltd). Sequence comparisons and alignments were performed using the BLAST online service available on NCBI (National Center for Biotechnology Information [http://blast.ncbi.nlm.nih.gov/Blast.cgi]), BioEdit and ClustalW . […]

Pipeline specifications

Software tools Chromas, BioEdit, Clustal W
Application Sanger sequencing
Organisms Cupriavidus necator
Diseases Amino Acid Metabolism, Inborn Errors, Pelger-Huet Anomaly
Chemicals Acetyl Coenzyme A, Acyl Coenzyme A, NAD, Pyruvic Acid, Citric Acid, Succinic Acid, Oxaloacetic Acid