Dataset features

Specifications


Application: CLIP-seq analysis
Number of samples: 12
Release date: Apr 6 2015
Last update date: Oct 18 2018
Access: Public
Diseases: Neoplasms, Neural Tube Defects
Computational protocol: FASTX-Toolkit, TopHat, GENCODE
Dataset link eIF3 PAR-CLIP in 293T cells

Experimental Protocol


293T cells were treated with 4-thiouridine and protein-RNA complexes were crosslinked, and eIF3-RNA complexes were immunoprecipitated. Replicate 1 includes use of primer ID on the 5' end ("NNNNNNNNGUAC"). The 3' adapter used for all samples was: 5’ rApp /TGGAATTCTCGGGTGCCAAGG/ 3ddC/

Repositories


GEO

GSE65004

ArrayExpress

E-GEOD-65004

ENA

SRP052300

BioProject

PRJNA272706

Download


Dataset Statistics

info

Citations per year

Dataset publication