Computational protocol: A genetic association study of DNA methylation levels in the DRD4 gene region finds associations with nearby SNPs

Similar protocols

Protocol publication

[…] SNP genotypes for the extensively investigated CEPH sample (see [] for further description) were downloaded from the HapMap website on April 8th 2009 ( http://hapmap.ncbi.nlm.nih.gov/ - HapMap Rel 27 Phase II + III, Feb 09, NCBI 36 assembly, dbSNP b126). Genotypes for SNPs within 10kb up- and downstream of the DNA methylation-assayed region were downloaded. 6 SNPs with an MAF <0.05 were excluded from the analysis. The remaining SNP genotypes for the 89 individuals within our sample were input into Haploview, where the ‘tagger’ function was used, with an r2 threshold of 0.8, to select 5 SNPs offering optimum coverage (rs11246221, rs3758653, rs752306, rs11246228, rs936465) of the region []. All SNPs were in Hardy-Weinberg equilibrium at the p > 0.01 level. Figure graphically depicts the DRD4 gene region investigated. The significant associations of two SNPs – rs3758653 and rs936465 – were tested for replication in the 18 Maudsley Brain Bank samples. The SNPs were genotyped via restriction enzyme digestion of PCR products, followed by size descrimination using gel electrophoresis. The primers CCCTCCACTCCAGGCCTCCC and CCTCCATTCCCTCCGGCCCA were used to amplify a 347bp region surrounding rs3758653, which was then digested using EcoRI according to the manufacturer’s instructions. EcoRI cuts the PCR product only if the C allele is present. The primers GCTGCCACCCTACCCCAGGT and GCACTGGGCTGGGCCTGAAC were used to amplify a 203bp region surrounding rs936465, which was then digested with Hpy166II according to the manufacturer’s guidelines. Hpy166II selectively cuts the PCR product if the G allele is present on the genomic + strand. Both SNPs had an MAF > 0.05 and were in Hardy-Weinberg equilibrium at the p > 0.01 level. […]

Pipeline specifications

Software tools Haploview, Tagger
Databases dbSNP
Application GWAS
Diseases Genetic Diseases, Inborn
Chemicals Dopamine