Computational protocol: Regulation of spindle pole body assembly and cytokinesis by the centrin-binding protein Sfi1 in fission yeast

Similar protocols

Protocol publication

[…] About 109 M46 cells grown on a YE5S plate were harvested, and genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre Biotechnologies, Madison, WI). Genomic DNA was fragmented to the size range of 200–1000 base pairs by sonication. Fragmented DNA was end repaired, dA-tailed using the NEBNext kit (NEB, Ipswich, MA), and ligated to preannealed adaptor oligonucleotides (5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAT-3′ and 5′-P-TACAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3′). Ligation products of 300–500 base pairs were size selected by gel purification and amplified by PCR for 14 cycles using primers 5′-AATGATACGGCGACCACCGAGATC­TACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAA­GCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3′. The PCR products were purified with the Illustra GFX kit (GE Healthcare, Little Chalfont, UK) and sequenced on an Illumina Hi-Seq 2000 for 49 cycles using the standard sequencing primer. Sequencing read mapping and single nucleotide polymorphism (SNP) calling were carried out using MAQ (). Annotation of the SNPs was performed with SnpEff (). […]

Pipeline specifications

Software tools MAQ, SnpEff
Application WGS analysis
Organisms Schizosaccharomyces pombe, Saccharomyces cerevisiae, Homo sapiens