Computational protocol: Liver X Receptor Gene Polymorphisms in Tuberculosis: Effect on Susceptibility

Similar protocols

Protocol publication

[…] PCR primers were designed using Primer 3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). The primers are shown in . To determine the frequency of known SNPs and potential functional SNPs in LXRs, the coding exons and sequence promoter regions were amplified and sequenced in 24 healthy controls and 24 patients, using previously described primers. Sequencing reactions were performed using Big-Dye v1.1 (Applied Biosystems, Foster City, USA). The sequencing data were aligned using Sequencher 4.2 (Gene Codes Corporation, Michigan, USA).Genomic DNA was extracted from 0.2 ml EDTA-anticoagulated blood samples using the QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer’s protocol. Genotyping of single nucleotide polymorphisms (SNPs) was performed using the SNaPshot kit purchased from Applied Biosystems. This is a rapid and robust assay used to simultaneously genotype SNPs using single nucleotide primer extension (mini-sequencing) and can obtain population genetic data.A 20 µl mixture was prepared to amplify all fragments in a Multiple PCR reaction and included 1x HotStarTaq buffer, 2.8 mM Mg2+, 0.3 mM dNTP, 0.1 µM of each primer, 1U HotStarTaq polymerase (Qiagen Inc.) and 1 µl template DNA. The cycling program was the following: 95°C for 15 min; 11 cycles of 94°C for 20 s, (62°C −0.5°C/cycle) for 40 s, 72°C for 1.5 min; 26 cycles of 94°C for 20 s, 56°C for 30 s, 72°C for 1.5 min; and 72°C for 5 min.After the completion of multiple amplification, we used shrimp alkaline phosphatase (SAP) and ExonucleaseI (ExoI) to purify the PCR product. Next, 2U SAP and 1U ExoI were added to 5 µl of PCR product. The mixture was incubated at 37°C for 80 min, followed by incubation at 75°C for 15 min. Next, the purified PCR products were used as templates for the mini-sequencing reaction using the commercially available SNaPshot Kit. To detect polymorphisms, we used the following mini-sequencing extension primers rs2248949SF: TTTTCAGGGGCTTTGGGAAGAGG, rs3758673SF: TTTTTTTTCCCTATCCCAGGCCTGCCA, rs2279238SR: TTTAGGCCTTGTCCCCACACAC, rs1405655SF: TTTTTTTTTTTTCTGAGAAAATTGAGGATCAGGC, rs1449626SF: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATCCGCCTCCAGGCCCAG, rs1449627SR: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGATGCCAAAGGAAAA, rs17373080SF: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGCATGAATGAGCTAAAGCCA, rs1052677SF: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGGCTCTCCCCCCTAGCC. The SNaPshot Extension Reaction mixture included 5 µl SNaPshot mix, 2 µl purified PCR product, 2 µl ultrapure water and 2 µl extension primer mix (0.8 µM for each extension primer). The cycling protocol was the following: 96°C for 1 min; 28 cycles of 96°C for 10 s, 52°C for 5 s, and 60°C for 30 s. To purify the extension products, we added 1 U SAP to the extension products, incubated at 37°C for 60 min and then incubated at 75°C for 15 min. One microlitre of purified extension product was then mixed with 9 µl HiDi Formamide and 0.5 µl Liz120 (Applied Biosystems) size standard and denatured at 95°C for 5 min. Next, we loaded the mixture on the ABI 3730×l DNA Analyser (Applied Biosystems). […]

Pipeline specifications

Software tools Primer3, Sequencher
Applications Population genetic analysis, qPCR
Organisms Mus musculus, Homo sapiens
Diseases Brain Diseases, Liver Diseases, Tuberculosis