Computational protocol: Discriminating between the Effects of Founding Events and Reproductive Mode on the Genetic Structure of Triops Populations (Branchiopoda: Notostraca)

Similar protocols

Protocol publication

[…] Extraction of DNA followed a modified version of the HotShot method described by Montero-Pau et al. . Aliquots of 75 µl of the lysis buffer and neutralizing solution were added and samples were incubated at 95°C for 45 minutes. Amplification of the mitochondrial control region (mtCR) was performed by polymerase chain reaction (PCR) with newly developed primers (dloopF 5′GCACGAGTTAAGCCGATCTT; dloopR 5′CCACATGATTTACCCTATCAAGG) for T. newberryi (n = 160) and T. l. “short” (n = 66). Reaction volumes of 25 µl consisted of 10 µl GoTAQ Green Master Mix (Promega Corp., Madison, WI), 400 pM of each forward and reverse primer and 1 ng/µl of genomic DNA. PCR reactions were run in a Fisher thermocycler (Fisher Scientific Inc., Pittsburgh, PA) with the following conditions: 94°C for 2 minutes, followed by 35 cycles of 94°C for one minute denaturation, 50°C for one minute annealing, 72°C for one minute elongation and a final extension of 72°C for 15 minutes. PCR products were checked for strength of amplification on a 1% agarose gel. Purification of PCR products was performed with ExoSAP-IT (USB Corporation, Clevland, OH) following manufacturer’s protocol. Purified PCR products were then sequenced by NMSU’s MOLBIO Molecular Analysis Service in both forward and reverse directions (http://mmas.research.nmsu.edu).Sequences were aligned using the assembly function in the program Geneious Pro v5.4.6 . Summary statistics, which included number of haplotypes, number of substitutions, number of transitions/transversions, number of polymorphic sites, nucleotide diversity (π), and haplotype diversity (h), for each playa and all samples collectively were obtained by Arlequin v3.5 . Relationships between haplotypes (maternal lineages) were resolved using the program TCS to construct a haplotype network at the 95% confidence level.The appropriate substitution model (TrN+I) for the data was selected based on the Akaike information criterion (AIC) using Modeltest v3.7 . The genetic distance between populations and between haplotypes using the p-distance and the Tamura-Nei model were calculated in the program MEGA v5.05 with uniform rates among sites and gaps treated as missing data .The program Arlequin v3.5 was used to calculate an AMOVA and also generate pairwise ΦST values. A sequential Bonferroni analysis was utilized to correct for multiple, nominal tests in the pairwise analysis. Pairwise genetic distances [ΦST/(1−ΦST)] were directly compared to log transformed pairwise geographic distance between the playas to test an isolation by distance hypothesis with the IBDWS v3.21 utility on the web that uses a Mantel test for the analysis , . [...] Genomic DNA for the microsatellite analysis was extracted by the phenol-chloroform protocol and DNA was stored at −20°C. A total of 163 T. newberryi from six ponds and 156 T. l. “short” samples from six ponds were genotyped for eight loci developed specifically for Triops species found in southern New Mexico (TL-L-1, TL-S-5, TL-S-9, TL-S-13, TN-6, TN-7, TN-13, TN-14 ) and one microsatellite designed for T. cancriformis (TCB-99 ). To guarantee the loci are informative for both species , loci were chosen based on the primers’ ability to PCR-amplify DNA in both species and secondly to contain more than one allele per locus in order to avoid ascertainment bias as described in Ellegren et al. . PCR reactions were done in an UNO II cycler (Biometra, Göttingen) in a 15 µl reaction volume containing 0.3 pmol/µl forward and reverse primers (biomers.net, Ulm), 0.1 pmol/µl Cy5-labled M13 , 1X PCR-Buffer (10x reaction buffer without detergent or MgCl2; BD Solis Biodyne, Tartu, Estonia), 2.5 mM MgCl2, 0.2 mM DNTPs, 0.04 U/µl Taq-Polymerase (Fire Pol DNA polymerase, Solis Biodyne, Tartu, Estonia) and 2 ng/µl genomic DNA. Microsatellite PCR reaction conditions were 95°C for 3 minutes, followed by 35 cycles of 94°C for 30 seconds denaturation, primer specific annealing temperature for 60 seconds, and 72°C for 60 seconds elongation, before a final extension at 72°C for 3 minutes. Genotyping of all samples was performed on an Automated Laser Flourescence (ALF) II express (Amersham Pharmacia Biotech, Nürnbrecht). Internal and external standards as well as one reference sample (previously sequenced sample) were included on each gel to facilitate consistent scoring across gels. Alleles were scored with the AlleleLinks 1.02 software (Amersham Parmacia Biotech).The expected and observed heterozygosity of each population and linkage disequilibrium were calculated in Genepop on the Web v4.0.10 and Bonferroni corrections were applied . The dataset was checked for null alleles using the program FreeNA and applying the EM algorithm to compare amplification success of non-specific microsatellite markers on the different species. Values are not reported due to the difficulty of assessing heterozygote deficit vs. null alleles in organisms with high inbreeding and are instead used only as a proxy for successful marker amplification. GenAlEx v6.41 was used for an AMOVA to determine amount of variation between and within populations. The overall and pairwise F ST, their significance values, F IS (the inbreeding coefficient), and allelic richness was calculated in FSTAT v2.9.3.2 as well as a two-sided statistical test to compare allelic richness, observed heterozygosity, F IS and F ST between species . The proportion of selfing (S) in each population was calculated, based on the estimated F IS values, using the equation S = 2F IS/(1+F IS) . It is noted that there can be a bias when estimating S if the F IS values do not accurately represent inbreeding, and are instead from genotyping error or population substructure . Estimates of inbreeding and selfing rate were compared to the percentage of males in T. newberryi populations, as it would be expected that an increased proportion of males would cause an increase in the rate of outcrossing, therefore lowering selfing estimates. The migration rate (Nm) between populations of Triops was calculated in GenAlEx v6.41 . Similar to the mitochondrial data, genetic distance, defined as F ST/(1−F ST), was compared to log geographic straight line distance between playas to detect the presence of isolation by distance using the IBDWS v3.21 utility on the web that uses a Mantel test for the analysis .To visually determine the genetic structuring between populations within a species, a discriminant analysis of principal components (DAPC ) was performed using the adegenet v1.3–5 package in the R platform v2.15.2 . DAPC overlooks the within group variation and summarizes the amount of between group variation, making this method superior for assessing relationships between populations . A factorial correspondence analysis (FCA) of both species together was performed in GENETIX v4.05.2 to visually assess species designation and if hybrid individuals are present in the sample set . […]

Pipeline specifications

Software tools Geneious, Arlequin, ModelTest-NG, MEGA-V, IBDWS, Genepop, GenAlEx, adegenet
Applications Phylogenetics, Population genetic analysis, GWAS
Organisms Triops longicaudatus, Caenorhabditis elegans, Homo sapiens
Diseases Disorders of Sex Development