Computational protocol: Autophagy Activation Clears ELAVL1/HuR-Mediated Accumulation of SQSTM1/p62 during Proteasomal Inhibition in Human Retinal Pigment Epithelial Cells

Similar protocols

Protocol publication

[…] RNA was extracted from total homogenates, immunoprecipitated pellets and relative “input signals” by using RNeasy Micro Plus Kit (Qiagen, 74034). The reverse transcription was performed following standard procedures. PCR amplifications were carried out using the Lightcycler instrument (Roche Molecular Biochemicals) in the presence of QuantiTect SYBR Green PCR mix (Qiagen, 204143) with primers designed by using the PRIMER3 software (www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cg). Primer sequences were as follows: ELAVL1/HuR, 5′-GAGGCTCCAGTCAAAAACCA -3′ (upstream), 5′-GTTGGCGTCTTTGATCACCT -3′ (downstrem); SQSTM1/p62, 5′- CTGGGACTGAGAAGGCTCAC -3′ (upstream), 5′- GCAGCTGATGGTTTGGAAAT -3′ (downstream); RPL6, 5′- AGATTACGGAGCAGCGCAAGATTG-3′ (upstream), 5′- GCAAACACAGATCGCAGGTAGCCC-3′ (downstream). The RPL6 mRNA was chosen as the reference on which the ELAVL1/HuR and SQSTM1/p62 values were normalized because it remained relatively stable during all the treatments and it does not bear adenine/uracil-rich elements (ARE) sequences (not shown).In the statistical analysis the GraphPad Instat statistical package (version 3.05 GraphPad software, San Diego) was used. The data were subjected to analysis of variance (ANOVA) followed, when significant, by an appropriate test, in function of the number of samples. Differences were considered statistically significant when p values <0.05. [...] Patients with dry AMD rich with drusen had been diagnosed based on biomicroscopy and fundus photographs in the Department of Ophthalmology of Freiburg University Hospital. The study was approved by the Ethics Committee of the Freiburg University Hospital and the tenets of the Declaration of Helsinki were followed. Eyes from two age-matched patients without clinically diagnosed AMD were used as a control; one eye was provided by the Department of Ophthalmology of Freiburg University Hospital and the other one by the Department of Ophthalmology of University of Debrecen. In both cases, the tenets of the Declaration of Helsinki were followed. Enucleated eyes from cadaver human samples were embedded in paraffin according to a routine protocol and horizontal sections (5 µm) of four eyes were immunostained for SQSTM1/p62, ubiquitin (Ub) and ELAVL1/HuR. The extent of immunopositivity in the retinal pigment epithelial cells was evaluated microscopically (no staining or positive staining) by selecting 5 mm long areas of the foveomacular, perimacular and peripheral regions. All the horizontal sections were, based to the histological anatomy, from the corneal level. Foveomacular, perimacular and peripheric areas were analysed as a pack from the same horizontal section. The stainings were done with Thermo Scientific's UltraVision LP Detection System AP Polymer & Fast Red Chromogen (TL-015-AF) kit according to the manufacturer’s instructions. The antibodies used were mouse monoclonal for SQSTM1/p62 (Santa Cruz, sc-28359), rabbit polyclonal for ubiquitin (Dako, Z0458) and the mouse monoclonal for ELAVL1/HuR (Santa Cruz, sc-5261). The dilutions were 1∶500, 1∶1100 and 1∶500 respectively. Human brain with Alzheimer's disease was used as a method control for the stainings (data not shown). After the staining samples were analyzed as described above, using a Zeiss AX10 Imager A2 (Göttingen) light microscope and a Jenoptik ProgRes C5 (Optical Systems) digital camera mounted on to the microscope. Photographs were taken with the same camera. The statistical analysis for the results was conducted with a Mann-Whitney test in the SPSS Statistics 17.0 program (IBM SPSS Inc). […]

Pipeline specifications

Software tools Primer3, SPSS
Applications Miscellaneous, qPCR
Organisms Homo sapiens
Diseases Blood Protein Disorders, Macular Degeneration, Neurodegenerative Diseases