Computational protocol: Multiple factors interact to produce responses resembling spectrum of human disease in Campylobacter jejuni infected C57BL/6 IL-10-/- mice

Similar protocols

Protocol publication

[…] Total DNA was extracted from tissue and fecal samples using DNeasy Tissue Kit (Qiagen, Valencia, CA) and was assayed by species-specific PCR for the C. jejuni gyrA gene as previously described [,]. Pathogenicity gene complements of the C. jejuni strains were determined using published PCR assays cited in Table ; the 9.6 kbp LOS fragment was generated using the Expand Long Template PCR System (Roche, Mannheim, Germany). Primers for luxS were generated using the web-based Primer3 program []  http://jura.wi.mit.edu/rozen/papers/rozen-and-skaletsky-2000-primer3.pdf: GGTTGTCGCACGGGTTTTTA (forward) and GGCAATTTGTTTGGCTTCAT (reverse). Cycling conditions were 2.0 mM MgCl2, denaturation at 95°C for 1 min followed by 30 cycles of 94°C for 30 s, 49°C for 1 min, 72°C for 2 min, and final extension at 72°C, 10 min. RFLP analysis of virulence determinants was conducted as follows. PCR products for flaA, LOS, cdtABC, ceuE, pldA, ciaB, dnaJ, and cgtB were digested with DdeI, RsaI, or HhaI to generate restriction fragment length polymorphism (RFLP) patterns. DNA extraction from bacterial cultures, restriction enzyme digestion, agarose gel electrophoresis, and ethidium bromide staining were performed using standard methods []. Stained gels were visualized and photographed using an Alpha Innotech UV transilluminator (Alpha Innotech, San Leandro, CA). Banding patterns were scored visually.Multilocus sequence typing (MLST) of strain NW (GenBank accession numbers FJ361183 through FJ361189) was performed using genes, primer sets, and cycling conditions described at the Campylobacter jejuni Multi Locus Sequence Typing website http://pubmlst.org/campylobacter/ developed by Keith Jolley and Man-Suen Chan and sited at the University of Oxford []. DNA sequencing was performed at the MSU Genomics Technology Support Facility. Each PCR product was initially sequenced in both directions; additional sequencing was done as necessary to resolve discrepancies. [...] Cluster analysis based on DNA sequences of housekeeping loci of the C. jejuni strains utilized sequence data from the Campylobacter jejuni Multi Locus Sequence Typing website http://pubmlst.org/campylobacter/[] and data generated in our laboratory for strain NW. Alignment and clustering were performed with ClustalW2 http://www.ebi.ac.uk/Tools/clustalw/index.html#[] using default parameters. Reference strains established by Wareing et al. [] were also included. Clustering analysis of manually scored RFLP patterns was performed using the Cluster V0.1 calculator http://www2.biology.ualberta.ca/jbrzusto/cluster.php developed by John Brzustowski []. The Jaccard similarity coefficient and the Saitou and Nei neighbor-joining clustering method were used.Fisher's exact test and the Freeman Halton extension of Fisher's exact test were performed using the VassarStats calculator http://faculty.vassar.edu/lowry/VassarStats.html[].Kaplan Meier log rank survival analyses were performed using SigmaStat 3.1 (Systat Software, Port Richmond, CA).Gross pathology, histopathology, and ELISA data were analyzed using SigmaStat 3.1. The nonparametric Kruskal Wallis one-way ANOVA was used for gross pathology and histopathology scores in the serial passage experiment. Scores for analysis of gross pathology data were assigned as follows: no gross pathology, 1; either enlarged ileocecocolic lymph nodes or thickened colon wall, 2; both enlarged ileocecocolic lymph nodes and thickened colon wall, 3; enlarged ileocecocolic lymph nodes, thickened colon wall, and bloody contents in lumen, 4. Kruskal Wallis nonparametric one-way ANOVA was performed on these scores; if a significant result was obtained, post hoc comparisons were made using Fisher's exact test. For this test, the two-way table was cast so that mice with no gross pathology (score of 1) were compared to mice having all levels of gross pathology (scores 2, 3, and 4) combined; correction for multiple comparisons was done using the Holm-Šidák procedure []. Histopathology scores were analyzed as previously described []. Two-way ANOVA and post hoc tests with correction for multiple comparisons were used for gross pathology and histopathology scores in the diet comparison experiment; because scores were not normally distributed, the analysis was performed on ranks rather than raw scores.Histopathology scores from the serial passage experiment were further analyzed using the Mantel test for trends with correction for continuity []; for this test, data were cast in a two-way table for each C. jejuni strain according to the number of the serial passage of the strain and the number of animals exhibiting lesions of grades 0 and 1 combined (scores ≤ 19) compared to the number of animals exhibiting lesions of grade 2 (scores ≥ 20). The choice to divide the data in this way for this analysis was made because almost all of the medians of the histopathology scores of C57BL/6 IL-10-/-mice infected with non-adapted C. jejuni 11168 for 28–35 days in previous experiments fell into grade 1 (median scores between 9.5 and 19; [] and unpublished data), whereas the median scores of mice infected with serially passaged C. jejuni 11168 all fell into grade 2.ELISA data were transformed as previously described [] prior to analysis by one or two-way ANOVA with post hoc tests using SigmaStat 3.1.GACK analysis was performed on the microarray data using programs available at http://falkow.stanford.edu/whatwedo/software/software.html[]. […]

Pipeline specifications

Software tools Primer3, Clustal W, VassarStats
Databases PubMLST
Applications Miscellaneous, qPCR
Organisms Campylobacter jejuni, Mus musculus, Homo sapiens
Diseases Campylobacter Infections, Ectromelia, Infectious, Gastroenteritis, Infection, Autoimmune Diseases of the Nervous System