Computational protocol: Telomere Dynamics and Homeostasis in a Transmissible Cancer

Similar protocols

Protocol publication

[…] Relative telomere repeat copy number was analysed by quantitative PCR (Q-PCR) as described by Cawthon . Telomere specific primers were adopted from Cawthon , Tel1: 5′- GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT -3′; Tel2, 5′-TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA -3′. RPLP0 (also called 36B4) gene was chosen as single copy gene following the methodology of Cawthon , and the single copy presence of this gene in the Tasmanian Devil genome was confirmed by searching the genome for alternative copies of the gene. No alternative RPLP0 copies or pseudogenes were found. RPLP0 gene specific primers were designed based on the Tasmanian Devil genome sequence , using the Primer3Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi), RPLP0_F: 5′- CTTCCCGTTCACCAAAGAAG -3′ and RPLP0_R: 5′- TGTTCTGGACTGGCAAAGTG -3′. The Q-PCR reactions were performed on the RotorGene6000 (Qiagen, Germantown, MD) in 15 µl total volume, containing 7.5 µl of Qiagen 2xQuantifast Sybr Green PCR master mix (Qiagen, Germantown, MD), 0.5 µM forward and reverse primers (the optimal primer concentrations) and 1 µl of gDNA (1 ng/µl concentration). Q-PCR conditions were established according to the manufacturer protocol: 95°C for 5 min denaturation followed by 40 cycles of 95°C for 15 s and 60°C for 30 s (annealing temperature). Fluorescence signal was acquired at the annealing temperature. Standard curves were generated using serial 1∶5 (RPLP0) and 1∶10 (Telomere) dilutions of a composite sample containing equal parts of DNA from spleen and tumour tissue extracts. All dilutions were run in triplicate. Standard curves had an R2>0.985 (RPLP0 reaction: R2 = 0.985 and Telomere reaction R2 = 0.997) and contained at least four (Telomere reaction) or five (RPLP0 reaction) dilutions from the dilution series with a linear dynamic range of at least 3 orders of magnitude and had PCR efficiencies between 1.3 and 1.1 (respectively). All samples were run in quadruplicate, and all Cq values for unknowns fell within the linear quantifiable range of the appropriate standard curves. The program Rest was used to calculate the normalised fold change of the target gene compared to the reference gene. This program package also corrects for different reaction efficiencies. Statistical significance (P<0.05) was determined by a Pair Wise Fixed Reallocation Randomisation Test© as described by Pfaffl et al .. [...] Relative quantifications of telomere copy numbers and gene expression were performed using sample crossing points, and data was analysed with the RotorGene6000 software 1.7. (Qiagen, Germantown, MD), applying the “second derivative maximum” method . The Excel application Best-Keeper was used to check the data for statistical significance, normality and reliability, and the normaliser gene GUSB was chosen as reference based on BestKeeper calculations . The program Rest was used to calculate the normalised fold change of the target gene compared to the reference gene. Statistical significance (P<0.05) was determined by a Pair Wise Fixed Reallocation Randomisation Test© as described by Pfaffl et al. . When data could not be transformed to achieve normality non-parametric statistics were applied using the software packages StatsDirect and JMPv5 , . […]

Pipeline specifications

Software tools Primer3, BestKeeper
Application qPCR
Organisms Sarcophilus harrisii
Diseases Neoplasms