Computational protocol: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias

Similar protocols

Protocol publication

[…] DNA extraction was carried out on total blood using Archive Pure DNA Blood Kit (5-PRIME, Hamburg, Germany) according to the manufacturer's recommended protocol.We genotyped our patients for the following two variants: RyR2 Q2958R (rs34967813, A/G), involving a substitution of adenine with guanine within exon 61, which results in the substitution of arginine for glutamine; HRC S96A (rs3745297, G/T), involving a substitution of guanine with thymine within exon 1, which results in the substitution of alanine for serine. RyR2 Q2958R (rs34967813, A/G), involving a substitution of adenine with guanine within exon 61, which results in the substitution of arginine for glutamine; HRC S96A (rs3745297, G/T), involving a substitution of guanine with thymine within exon 1, which results in the substitution of alanine for serine.The DNA polymorphism analyses were performed using AS-PCR. The primers were designed with the Primer3 software []. Primer sequences, annealing temperature, and amplification product sizes are shown in . PCR amplifications were carried out in a total reaction volume of 25 μL, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer. The reaction cycle conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles of 30 s denaturation at 94°C, 30 s annealing at varying temperatures (see for specific annealing temperatures), and 30 s extension at 68°C, with a final extension at 68°C for 5 min.Allele-specific primers were constructed by introducing a one-base mismatch sequence before the SNP site. After agarose-gel electrophoresis, the PCR product was visualized with ethidium bromide, photographed, and genotyped.Due to deviation from Hardy-Weinberg equilibrium (HWE), to exclude genotyping errors, all genomic DNAs genotyped for RyR2 Q2958R were subjected to direct sequencing. Primers used for direct sequencing were CTACAGATGGTGGCAGCAGA (upper primer) and GCAGGACTAAGGTCCCACAA (lower primer). [...] Continuous data are expressed as the mean ± standard deviation; categorical data are expressed as a percentage. A goodness of fit test for normality and a Brown-Forsythe or Levene test for homogeneity of variances were used to assess the applicability of parametric tests. Differences between mean data were compared by Student's t-test for the normally distributed continuous variables or by the Mann-Whitney test for nonnormally distributed variables. Differences in genotype frequencies and other categorical data between cases and controls were compared with Fisher's exact test (mid-p exact p value) and, in Hardy-Weinberg disequilibrium (HWD), with Armitage trend test. The consistency of the genotype frequencies with the HWE was tested using a chi-squared goodness-of-fit test on a contingency table of observed versus expected genotypic frequencies in cases and controls. Post hoc evaluations, where necessary, were performed by means of the Bonferroni correction. The MedCalc Statistical Software version 13.3 (MedCalc Software bvba, Ostend, Belgium; http://www.medcalc.org; 2014) was used for the multivariate logistic regression analysis. A two-sided p value <0.05 was considered significant for all tests. […]

Pipeline specifications

Software tools Primer3, MedCalc
Applications Miscellaneous, qPCR
Organisms Homo sapiens
Diseases Heart Diseases, Heart Failure, Hypertension
Chemicals Calcium, Ryanodine