Computational protocol: A genetic analysis of Trichuris trichiura and Trichuris suis from Ecuador

Similar protocols

Protocol publication

[…] A parasitological survey of humans and pigs was conducted in Quinidé and Súa Districts, Esmeraldas Province, Ecuador []. 32 families (n = 132) were enrolled. Pigs (n = 46) were selected for sampling based on their proximity to Trichuris-positive children. Participants were asked to provide a faecal sample and faecal samples were collected from pigs. Parasitological diagnosis was conducted by examination of duplicate Kato-Katz smears []. Ethical approval was provided by the Ethical Committees of Liverpool School of Tropical Medicine and Pontificia Universidad Catolica del Ecuador []. Written informed consent was provided by all participants or their guardians (for children). STH-positive individuals were treated with 400 mg albendazole or pyrantel pamoate (see below).To collect adult worms, participants with T. trichiura counts ≥480 eggs per gram faeces were given pyrantel pamoate at 10 mg/kg over three days. Participants and their guardians were instructed to collect stools produced. Recovered worms were washed thoroughly before storage in 70% ethanol. Trichuris-positive pigs were treated with piperazine at 0.2 g/kg. Expelled worms were collected over the following two days. Morphometric analysis of adult Trichuris was carried out as described []. Discriminant analysis was conducted in SPSSv20 starting with four morphometric characteristics (female worms), which were removed or exchanged in a stepwise fashion to identify the most discriminatory combination. A maximum of three characteristics was used for male worms due to the small number obtained from pigs. The data for female worms did not meet the assumption of equal variance among groups.Genomic DNA was extracted from Trichuris using the Wizard Genomic DNA Purification Kit. Internal Transcribed Spacer-2 (ITS-2) PCR-RFLP was conducted as described []. An 18S DNA PCR-RFLP was designed. Restriction sites were identified using Webcutter2.0 and Alu1 differentiated between human and pig Trichuris. The primers were: Tri18S_F1 (5′- CGAACGAGACTCTGGCCTAC) and Tri18S_R (5′- CCTTGTTACGACTTTTACTTCCTC). Cycling conditions were: denaturation at 95°C for 15 min, followed by 35 cycles of 95°C for 30s, 55°C for 1 min and 72°C for 1 min, with a final extension of 72°C for 5 min. PCR products (4 μl) were digested with 4U Alu1.29 worms (15 from four humans and 14 from a pen containing four pigs) were chosen for mitochondrial large ribosomal subunit (rrnL) sequencing. 422 bp of rrnL were amplified using primers TrirrnLF (5′-TGTAAWTCTCCTGCCCAATGA) and TrirrnLR (5′-CGGTTTAAACTCAAATCACGTA). PCR conditions were: initial denaturation at 95°C for 15 min followed by 35 cycles of 95°C for 30s, 50°C for 30s and 72°C for 1 min and a final extension at 72°C for 10 min. For comparison, 10 pig worms from Denmark and USA were analysed and additional sequences were retrieved from GenBank: Chinese T. suis (AM993027-AM993032, HQ183734-HQ183736 and GU070737) and T. trichiura (AM993017-AM993022). Phylogenetic analysis using neighbor-joining and maximum-likelihood trees was conducted in MEGA6.1 [] using jModelTest to identify the best model []. Trichinella spiralis (AF293969) was used as an outgroup. Ecuadorian rrnL sequences were submitted to GenBank (KP781884-KP781912). […]

Pipeline specifications

Software tools Webcutter, MEGA, jModelTest
Applications Genome annotation, Phylogenetics
Organisms Caenorhabditis elegans, Trichuris trichiura, Trichuris suis, Homo sapiens, Sus scrofa