Computational protocol: Molecular basis of an agarose metabolic pathway acquired bya human intestinal symbiont

Similar protocols

Protocol publication

[…] The Ag-PUL was first analyzed for the presence of candidate GH117 and GH86 genes within the genome of Bu NP1 (available on the Broad Institute website: www.broadinstitute.org/) using the dbCAN website. The genetic neighborhood surrounding identified candidate agarases were then systematically characterized using Artemis. Identified ORFs were trimmed, exported, and annotated manually using dbCAN and BLASTp. To determine the putative region of insertion of the Ag-PUL into the ancestral Bu chromosome, the non-agarolytic strain Bu ATCC 8492 was used as a sequenced referenced genome. The genomes of each bacterium were compared using Sequencher (Ann Arbor, MI). Contigs that aligned with 60% sequence similarity over a 40 kbp region were gathered for further analysis. After aligning the genomes, it was observed that the deposited genome of Bu ATCC 8492 was incomplete in this region and did not provide full sequence coverage. Therefore, the sequence region between contigs AAYH02000031.1 and AAYH02000048.1 was amplified using PCR primers BuATCC8492_AgPULFor2 (CACATATCCGGCAGCCTTACTTGCATTTCC) and BuATCC8492_AgRev3 (TCAACTATTGGTGGTTGCGTTGTCCTAACA) and sequenced. To determine the exact site of insertion, 50 kbp upstream and downstream of the insertion site in Bu ATCC 8492 and Bu NP1 was determined using webPRANK via EMBL. Regions adjacent to expected insertion sites were then extracted from this sequence data and the 50 kbp regions were aligned. […]

Pipeline specifications

Software tools dbCAN, BLASTP, Sequencher, PRANK
Application Protein sequence analysis