Computational protocol: Tc-MYBPA an Arabidopsis TT2-like transcription factor and functions in the regulation of proanthocyanidin synthesis in Theobroma cacao

Similar protocols

Protocol publication

[…] Total RNA from stage A/B leaves of Theobroma cacao (Scavina 6) was isolated using a modified cetyl trimethyl ammonium bromide (CTAB) extraction method as previously described [] with the following modifications. RNA isolated from the CTAB extraction and LiCl precipitation was further purified and concentrated using RNeasy columns (Qiagen, Valencia, CA, USA), but the phenol/chloroform extraction and sodium acetate/ehanol precipitation steps were omitted. The quality of RNA was verified by observing absorbance ratios of A260/A280 (1.8-2.0) and A260/A230 (1.8-2.2) and by separating 200 ng RNA samples on 0.8 % agarose gels to examine intact ribosomal bands.First strand cDNA was synthesized using the SMART RACE cDNA amplification kit (Clontech, Mountain View, CA, USA). The putative EST sequence of Tc-MYBPA was obtained by searching the Theobroma cacao EST database (http://esttik.cirad.fr/) [] using BLAST (program: tBLASTn) [] with the protein sequence of TT2 (AT5G35550) from Arabidopsis thaliana as the query sequence. The ORF of putative Tc-MYBPA was amplified with the Advantage cDNA PCR Kit (Clontech, Mountain View, CA, USA) using cDNA from stage A/B leaves as template with the following primer pairs: Tc-MYBPA_F (5’- GTCCATGGGAAGGGCTCCTTGTTGTTC -3’) and Tc-MYBPA_R (5’- AGCGGCCGCTCAGATCAATAATGATTCAGC -3’). To facilitate the subsequent cloning into binary vectors, an NcoI site (CCATGG) was added at the start codon (ATG) and a NotI site (GCGGCCGC) was added immediately 3' to the stop codon (TCA) respectively (sites are shown in italics and the start or stop codons are underlined). The PCR reaction was carried out in a total volume of 20 μL at 94 °C for 5 min; 5 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; another 23 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min; followed by a final extension at 72 °C for 5 min. The PCR products were gel purified and cloned into the pGEM-T Easy plasmid (Promega, Madison, WI, USA) and replicated in E. coli strain DH5α. DNA sequencing was performed using 12 of the resulting DNA clones (pGEMT-Tc-MYBPA), and two clones had the precise sequence of the consensus sequences. One clone (pGEMT-Tc-MYBPA-3) was chosen for cloning into the binary vector for plant transformation and subsequent experiments. [...] PA-specific R2R3-MYB protein sequences were retrieved from GenBank (http://www.ncbi.nlm.nih.gov/Genbank/), including AtTT2 from Arabidopsis (CAC40021) [], VvMYBPA1 and VvMYBPA2 from grape (AM259485, ACK56131) [, ], LjTT2a, LjTT2b and LjTT2c from Lotus japonicus (AB300033, AB300034, AB300035) [] and MYB134 from Populus tremuloides (FJ573151) []. A protein sequence alignment performed with the ClustalW algorithm was used to construct a phylogenetic tree using the neighbor-joining method in the MEGA package []. One thousand bootstrap datasets were used to estimate the confidence of each tree clade. Protein sequence alignment of anthocyanin- and proanthocyanin-specific MYB proteins was performed using the same method as was for the phylogenetic tree but was edited and displayed using GENEDOC software (Version 2.6.02, http://www.nrbsc.org/gfx/genedoc/gddl.htm). […]

Pipeline specifications

Software tools TBLASTN, Clustal W, MEGA
Applications Phylogenetics, Amino acid sequence alignment
Organisms Theobroma cacao, Arabidopsis thaliana, Homo sapiens
Chemicals Anthocyanins, Catechin, Proanthocyanidins