Computational protocol: Social odours covary with bacterial community in the anal secretions of wild meerkats

Similar protocols

Protocol publication

[…] We extracted DNA only from the mixed samples (derived from meerkat anal pouches) using a WIZARD Genomic DNA Purification Kit (Promega, Lyon, France), following the protocol described in Leclaire et al.. Two control samples, that had been collected in the field by opening the swab tubes for a few seconds, were extracted using the same protocol.PCR amplifications were performed in 30-μL mixtures containing 3 μL of diluted DNA extract. Each PCR mixture was composed of 1U of AmpliTaq Gold DNA Polymerase (Applied Biosystems, Foster City, CA, USA), 2.5 mM of MgCl2, 1x of Taq Buffer, 0.2 mM of each dNTP and 2.4 ng of bovine serum albumin (Promega Corporation, Madison, USA). PCR conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation (at 95 °C for 30 s), annealing (at 57 °C for 30 s) and elongation (at 72 °C for 30 s). We used universal primers that specifically amplified the v5-6 region (ca 295 bp length) of the bacterial 16 S rRNA gene (BACTB-F: GGATTAGATACCCTGGTAGT; and BACTB-R: CACGACACGAGCTGACG). To discriminate samples after sequencing, we labelled both forward and reverse primers at the 5′ end with a combination of two different 8 bp tags. The PCR products were purified, using the QIAquick PCR purification Kit (Qiagen GmbH, Hilden, Germany), and then pooled. Amplicons were then sequenced with an Illumina MiSeq platform, using the 2 × 250 bp protocol (Fasteris SA, Plan-les-Ouates, Switzerland). We included PCR blank controls in the sequenced multiplex to detect potential reagent contaminants.We analysed the sequence reads following Taberlet and colleagues, with some adjustments, using OBITools package. Briefly, after assembly of paired-end reads, we assigned reads to their respective samples (with 0 and 2 mismatches allowed on tag and primer sites, respectively) and excluded reads with low assembly scores or that contained ambiguous bases (i.e., “N”). We dereplicated strictly identical reads using the “obiuniq” algorithm and removed singletons (i.e., one single occurrence over the entire dataset, which likely indicates degraded sequences). We used the “obiclean” algorithm to detect and remove potential PCR/sequencing errors (Boyer et al. 2015). We then clustered the remaining sequences into Operational Taxonomic Units (OTUs) based on their similarity using the “sumaclust” algorithm (https://git.metabarcoding.org/obitools/sumatra/wikis/home), with a 97% similarity threshold. Taxonomic assignations were obtained using “ecotag” with the MOTHUR version of the SILVA bacterial database (release 102). We considered only the taxonomic assignation of the most abundant sequence of each OTU. Lastly, low abundance false positives have been repeatedly observed as a consequence of “tag-switching” events, . We therefore removed all OTUs that had a total read abundance of <10 reads. We used PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States) to predict metagenome functional content from 16S rRNA.OTU count data were standardized through conversion into intra-sample relative abundances, and the contribution of highly prominent OTUs to quantitative similarity index calculation was tempered by square-root transformations of the data. One subordinate male and one subordinate female had few bacterial sequences (2 and 12 sequences, respectively) in their samples, compared to the other individuals (mean ± SE: 4942 ± 192 sequences; range: 2104–8117 sequences), and were therefore excluded from the analyses. We excluded 241 OTUs from the analyses because they were more abundant in the PCR-specific controls than in the samples, and we excluded an additional 15 OTUs because they were more abundant in the sampling-specific controls than in the samples. The number of sequences did not differ between males and females (4942 ± 288 sequences vs. 4942 ± 264 sequences respectively; F1,40 = 0.01, P = 0.93) and between subordinates and adults (5100 ± 187 sequences vs. 4676 ± 410 sequences; F1,41 = 1.14, P = 0.29). OTUs sequences have been deposited in GenBank (accession numbers: KY630752–KY631487; Supplementary Table ). […]

Pipeline specifications