Similar protocols

Pipeline publication

[…] ) and RNeasy MinElute cleanup kit (Qiagen). The protocol was based on the standard in-house protocol and on the manufacturer’s instructions. RNA integrity was assessed by gel electrophoresis on agarose gel (staining with gel-red) and using a Bioanalyser 2100 (Agilent Technologies, Waldbronn, Germany). RNA sequencing (Illumina, 100 bp paired-end reads) was performed at the Beijing Genome Institute (China), and the analysis was carried out according to their standard procedure. Raw data were pre-processed and aligned using the RNA-Seq pipeline described in []. In short, reads were filtered for ribosomal RNA, trimmed and aligned to version 3 of the Populus trichocarpa reference genome [–] with STAR []. The number of reads aligning to annotated gene models was determined using HTSeq []. Read counts were normalized with a variance stabilizing transformation (VST) implemented in the R-package DESeq2 []. These gene expression values were used in further downstream analyses., Quantitative PCR (qPCR) analysis was run for RNA samples from three replicate trees per genotype after a DNAse treatment with DNA-free TM kit (Ambion), cDNA synthesis by iScript cDNA synthesis kit (Bio-Rad) and qPCR with LightCycler® 480 II (Roche) to analyse expression of PttSCAMP3 using primers GGAGGCTATGTTATGTGGTATCGC and CAGAGCACTATCTGTCCTCATTGC. A cyclophilin gene (Potri.004G168800) [] was chosen as a reference gene using GeNorm software as described earlier [], and amplified with primers GGCTAATTTTGCCGATGAGA and ACGTCCATCCCTTCAACAAC., Total proteins were extracted from 20 mg of frozen stem tissue powder […]

Pipeline specifications

Software tools STAR, HTSeq, DESeq2