Computational protocol: A multi omics approach reveals function of Secretory Carrier Associated Membrane Proteins in wood formation of​ ​​Populus​​ ​trees

Similar protocols

Protocol publication

[…] Total RNA was extracted using a RNeasy mini kit (Qiagen) supplemented with the RNAse-free DNAse set (Qiagen) and RNeasy MinElute cleanup kit (Qiagen). The protocol was based on the standard in-house protocol and on the manufacturer’s instructions. RNA integrity was assessed by gel electrophoresis on agarose gel (staining with gel-red) and using a Bioanalyser 2100 (Agilent Technologies, Waldbronn, Germany). RNA sequencing (Illumina, 100 bp paired-end reads) was performed at the Beijing Genome Institute (China), and the analysis was carried out according to their standard procedure. Raw data were pre-processed and aligned using the RNA-Seq pipeline described in []. In short, reads were filtered for ribosomal RNA, trimmed and aligned to version 3 of the Populus trichocarpa reference genome [–] with STAR []. The number of reads aligning to annotated gene models was determined using HTSeq []. Read counts were normalized with a variance stabilizing transformation (VST) implemented in the R-package DESeq2 []. These gene expression values were used in further downstream analyses.Quantitative PCR (qPCR) analysis was run for RNA samples from three replicate trees per genotype after a DNAse treatment with DNA-free TM kit (Ambion), cDNA synthesis by iScript cDNA synthesis kit (Bio-Rad) and qPCR with LightCycler® 480 II (Roche) to analyse expression of PttSCAMP3 using primers GGAGGCTATGTTATGTGGTATCGC and CAGAGCACTATCTGTCCTCATTGC. A cyclophilin gene (Potri.004G168800) [] was chosen as a reference gene using GeNorm software as described earlier [], and amplified with primers GGCTAATTTTGCCGATGAGA and ACGTCCATCCCTTCAACAAC. [...] For gas chromatography-mass spectrometry (GC-MS), metabolites were extracted and their profiles analyzed using an Agilent 6890 GC coupled to a Pegasus III time of flight MS, as described in []. The generated files were processed and the metabolites identified as described in [].For ultra high performance liquid chromatography-mass spectrometry (UHPLC-MS) analysis, one mL of extraction buffer (20/20/60 v/v chloroform:water:methanol) including the internal standards Reserpine (Sigma), Sulfadimethoxine (Fluka), Leucine-Enkephalin (Fluka) and Val-Tyr-Val (Bachem) was added to 9–12 mg of the plant material. The sample was shaken with a tungsten bead in a mixer mill at 30 Hz for 3 min, the bead was removed and the sample was centrifuged at +4 °C, 14,000 rpm, for 10 min. Then, 200 μL of supernatant were transferred to a micro vial and the solvents were evaporated. Before analysis, the sample was re-suspended in 10 + 10 μL methanol and water (with 0.1% formic acid). The chromatographic separation was performed on an Agilent 1290 Infinity UHPLC-system (Agilent Technologies, Waldbronn, Germany). Two μL of re-suspended aliquots of extracted plant sample were injected onto a 2.1 × 100 mm, 1.7 μm Kinetex C18 column (Phenomenex, Torrace, USA) held at 40 °C. The gradient elution buffers were A (H2O, 0.1% formic acid) and B (acetonitrile, 0.1% formic acid), and the flow-rate was 0.5 mL min−1. The compounds were eluted with a linear gradient consisting of 1–20% B over 0–4 min, 20–40% B over 4–6 min, 40–95% B over 6–9 min, the composition was held at 95% B for 4.5 min, and returned to 1% B at 14.50 min, the composition was kept at 1% B for a further 4.5 min before the next injection. The diode array detector was set to scan the interval 190–640 nm with a step length of 2 nm and a slit width of 2 nm. The compounds were detected with an Agilent 6540 Q-TOF mass spectrometer equipped with a jet stream electrospray ion source operating in negative ion mode. The settings were kept identical between the modes, with the exception of the capillary voltage. A reference interface was connected for accurate mass measurements; the reference ions purine (4 μM) and HP-0921 (Hexakis(1H, 1H, 3H–tetrafluoropropoxy phosphazine) (1 μM), both purchased from Agilent Technologies (Santa Clara, CA, USA), were infused directly into the MS at a flow rate of 0.05 mL min−1 for internal calibration, and their monitored ions were m/z 119.03632 and m/z 966.000725 for negative mode, respectively. The gas temperature was set to 300 °C, the drying gas flow to 8 L min−1 and the nebulizer pressure to 40 psig. The sheath gas temp was set to 350 °C and the sheath gas flow to 11 L min−1. The capillary voltage was set to 4000 V. The nozzle voltage was 0 V. The fragmentor voltage was 100 V, the skimmer 45 V and the OCT 1 RF Vpp 750 V. The collision energy was set to 0 V. The m/z range was 70–1700, and data were collected in centroid mode with an acquisition rate of 4 scans s−1 (1974 transients/spectrum). Mass Feature Extraction (MFE) from the data acquired was performed using the MassHunter™ Qualitative Analysis software package, version B05.00 (Agilent Technologies Inc., Santa Clara, CA, USA). Extracted features were aligned and matched between samples using Mass Profiler Professional™ 12.5 (Agilent Technologies Inc., Santa Clara, CA, USA).The metabolite annotation was done by manual interpretation of the fragments with high mass accuracy or by searches in an in house database. For critical samples, extracts from transgenic and wild-type plants were re-analyzed by Liquid Chromatography Quadrupole Time-of-Flight Mass Spectrometry (LC-Qtof) targeted MS/MS approach using the same chromatographic and mass spectrometry conditions as described above, with collision energy set up from 10 to 40 V. The metabolomic extracts were also re-analyzed by a lipidomic approach [] to improve annotations of metabolites with long retention times. […]

Pipeline specifications

Software tools STAR, HTSeq, DESeq2, Nozzle
Organisms Populus tremula