Computational protocol: The Interactive Effect of SIRT1 Promoter Region Polymorphism on Type 2 Diabetes Susceptibility in the North Indian Population

Similar protocols

Protocol publication

[…] Genomic DNA was isolated from peripheral blood through a routine protocol used in laboratories. We sequenced 1.46 kb upstream of the translation start site of the SIRT1 gene and observed eleven SNPs (rs12778366, rs3758391, rs7476338, rs35706870, rs3740051, rs34639502, rs34842975, rs932658, rs35995735, rs3740053, and rs2394443). However, only 7 SNPs (rs12778366, rs3758391, rs35706870, rs3740051, rs932658, rs3740053, and rs2394443) were found polymorphic in the North Indian population ( and ). For this purpose, oligos were designed using PRIMER 3 software . A primer pair (forward 5′ ACGCAACCAAAGATGGTTTT 3′ and reverse 5′ CTTCCAACTGCCTCTCTGG 3′) was used to amplify the whole region. The total PCR reaction mix made was 12.5 µl, containing ∼80 ng of template DNA, 6.25 pmoles of each primer, 300 µM of dNTPs, 1.5 mM of MgCl2, 1X reaction buffer, and 0.4 units of the Taq pol enzyme (Bangalore Genei, India). The cycling conditions were as follows: denaturation at 95°C for 1 min, followed by annealing at 62°C for 1 min, and then extension at 72°C for 1.5 min, repeated for 32 cycles followed by a final extension step at 72°C for 10 min. PCR products were initially checked in 1.5% agarose gel, sequenced using ABI Prism 3100–Avant Genetic Analyzer (Applied Biosystems, USA), and analysed in SeqScape software v2.1.1 (Applied Biosystems). Two internal primers (Forward 5′ TGCACGTGAGAAAACTGAGG 3′ and Reverse 5′ ACCTTTGACGTGGAGGTTTG 3′) were also used along with external primers for a complete sequencing without any gap. The genotypic data of mt-ND3 (rs2853826), PGC1α variants (rs2970847 and rs8192678), and UCP2 (rs659366) for the samples were retrieved from our earlier publication . Previously defined PCR and restriction digestion methodologies from literature were used to screen other candidate gene polymorphisms: PIK3R1 p.Met326Ile (rs3730089), IRS1 p.Gly971Arg (rs1801278), and PPP1R3 p.Asp905Tyr (rs1799999). For quality control and to confirm restriction digestions, direct sequencing was performed to screen these polymorphisms in 250 randomly selected samples, which showed 100% concordance, suggesting no error in restriction digestion methods. [...] The Hardy–Weinberg equilibrium was tested at each variant locus in a contingency table of observed versus predicted genotype frequencies using the chi-square test. Categorical variables were compared using the chi-square (χ2) test. Continuous data were shown as mean±SD. Logistic regression analysis was used to determine the independent and interactive associations of the allelic and genotypic status of the studied polymorphisms with T2DM. Corrections for age, sex, body mass index (BMI) and center of sample collection were also performed. Bonferroni correction was adopted for multiple hypothesis testing.Interaction between the various genotypes (different genes) was established mainly by binary logistic regression in statistical package for social science program (SPSS version 13.0; SPSS, Chicago, IL). The risk and protective genotype combinations for mt-ND3 rs2853826, PGC1α rs8192678, and UCP2 rs659366GG were first established (), also reported in our previous study . Further, considering SIRT1 as an upstream candidate, individuals with the SIRT1 rs12778366 (-1400) genotypic backgrounds (TT, TX, CX) were categorized and risk and protective genotypic distributions of downstream candidate genes: mt-ND3 rs2853826, PGC1α rs8192678, and UCP2 rs659366GG, were estimated in those backgrounds individually and collectively. These distributions in cases and controls were used to estimate the odd ratios (ORs) at 95% confidence interval (CI) and the respective p values. Empirical p values were also estimated for all risk Versus protective genotypes of mt-ND3 rs2853826, PGC1α rs8192678 and UCP2 rs659366 in the SIRT1 rs12778366 (-1400) genotypic backgrounds (TT, TX, CX) by logistic regression using PLINK adaptive permutations (maximum1,000,000 permutations). The linkage disequilibria between variants within the 1.4 kb region upstream the translation start site of the SIRT1 gene, the detection of tag single-nucleotide polymorphisms (SNPs) in the region, and haplotypic disease association were done using Haploview 4.0 software (www.hapmap.org). The statistical power of this study for each polymorphism was estimated by using PS software version 2.1.31 . The statistical analyses were mainly performed using the statistical package for social science program (SPSS version 13.0; SPSS, Chicago, IL). […]

Pipeline specifications

Software tools SeqScape, SPSS, PLINK, Haploview
Applications Miscellaneous, Sanger sequencing, GWAS
Organisms Homo sapiens
Diseases Diabetes Mellitus, Type 2