Computational protocol: Peripheral blood HIV-1 DNA dynamics in antiretroviral-treated HIV/HCV co-infected patients receiving directly-acting antivirals

Similar protocols

Protocol publication

[…] Plasma HIV-1 RNA was measured by a commercially available kit (Abbott RealTime HIV-1 assay, Abbott Park, Illinois, U.S.A) with a limit of detection (LOD) of 40 copies/mL and by a modified protocol of the same method to reach 5 copies/mL as LOD for residual HIV-1 viremia []. HCV RNA was quantified in plasma with the Abbott RealTime HCV assay with a LOD of 12 IU/mL.Total HIV-1 DNA was extracted from PBMC by QIAsymphony DNA Midi Kit (QIAGEN, S.r.l. Milan, Italy) and quantified by real-time PCR targeting LTR region. DNA was amplified with the sense primer NEC 152 (GCCTCAATAAAGCTTGCCTTGA) and the reverse primer NEC 131 (GGCGCCACTGCTAGAGATTTT) in the presence of a dually (FAM and TAMRA) labelled NEC LTR probe (AAGTAGTGTGTGCCCGTCTGTTRTKTGACT). As standard curve, dilutions of 8E5 cell DNA containing 1 proviral copy per cell were used []. Episomal unintegrated HIV-1 DNA was quantified by a specific PCR targeting a LTR region specific for 2-LTR circular forms [, ]. An additional real-time PCR targeting the housekeeping cellular hTERT gene was used to refer total HIV-1 DNA and 2-LTR copies to the amount of the cells present in the analysed samples []. All the in house real-time PCR have a LOD of 3 copies/reaction volume. The amount of 2-LTR forms was indicated as a fraction of total HIV-1 DNA.Viral diversity of PBMC-associated proviral HIV-1 DNA quasispecies was performed by limiting-dilution PCR as in []. In particular, a portion of the env gene coding for C2-V5 regions of viral glycoprotein 120 was amplified by nested PCR using the outer sense primer ATGGGATCAAAGCCTAAAGCCATGTG (position 6557–6582 in HXB2), the outer antisense primer AGTGCTTCCTGCTGCTCCCAAGAACCCAAG (position 7822–7792 in HXB2), the inner sense primer CAGCACAGTACAATGTACACA (position 7002–7021 in HXB2) and the inner antisense primer CTTCTCCAATTGTCCCTCA (position 7648–7666 in HXB2), using a proof-reading DNA polymerase (Platinum Taq DNA Polymerase High Fidelity, Thermo Fisher Scientific, Milan, Italy). For each infected subject, on average 7 (range, 4–7) sequences were obtained at the different time points before, during and after DAA treatment. All the amplicons were sequenced using the BigDye1.1 terminator kit (Applied Biosystems, Foster City, CA) following the manufacturer’s instructions, with the same primers used in the second round of nested PCR and an ABI310 automatic sequencer. Nucleotide sequences were aligned with the CLUSTAL W program, using BioEdit Software (version 7.0.5.3). Genetic heterogeneity (diversity, i.e. mean number of nucleotide substitutions/site) of the viral quasispecies was established using Kimura two-parameter substitution model by MEGA software package (Version 6.0). Relationships among the variants present at baseline and during DAA were evaluated constructing a maximum likelihood (ML) phylogenetic tree by MEGA program. Bootstrap values >80% were considered significant. […]

Pipeline specifications

Software tools Clustal W, BioEdit, MEGA
Application Phylogenetics
Organisms Human immunodeficiency virus 1, Homo sapiens, Human immunodeficiency virus 2, Classical swine fever virus
Diseases HIV Infections
Chemicals Interferons, Ribavirin