Computational protocol: Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data

Similar protocols

Protocol publication

[…] We attempted several rounds of PCR and sequencing for each specimen collected, with the exception of four Odorrana hosii Boulenger and three Ansonia thinthinae Wilkinson, Sellas, & Vindum. In addition to our samples from our expedition, we DNA barcoded 108 additional specimens of amphibians from previous USNM collections in Myanmar, mostly northern states, to verify if these were the same species that we collected in the Tanintharyi. Tissue of these specimens are from the USNM tissue collection and were initially collected into 95% EtOH and subsequently stored at -80 °C. Extractions of genomic DNA from all specimens were performed on an AutoGenprep 965 (2011 AutoGen, Inc.), using standard phenol manufacturer protocols. Genomic DNA was eluted in 100 µl of AutoGen R9 re-suspension buffer. Polymerase chain reactions (PCR) were conducted for the mtDNA large ribosomal subunit (rrnL: 16S) and cytochrome oxidase subunit I (COI) using the primers: 16Sar 5’ CGCCTGTTTATCAAAAACAT 3’ and 16Sbr 5’ CCGGTCTGAACTCAGATCACGT 3’ () and COI-ReptBCF 5’ TCAACAAACCAYAAAGAYATYGG 3’ and COI-ReptBCR 5’ TAAACTTCAGGGTGGCCRAARAATCA 3’ (). For some specimens, we also sequenced either part of the ND2 gene using the primers L4437–H5934 () or 12S (12SI: 5’ TGCCAGCAGYCGCGGTTA 3’ and 12SIII 5’ AGAGYGRCGGGCGATGTGT 3’; Puillandre et al. 2009) in order to compare with sequences available for these, or closely related species in GenBank. The PCRs were performed in 96-well plates, in 10 µl reactions, following protocols “3.6 PCR Methods: Amplification” and “3.8 PCR Purifications: EXOSAP-IT” of , with annealing temperatures of 54 °C for 16S and 12S, 48 °C for COI, and 52 °C for ND2. Sequence reactions were performed in 96-well plates with the PCR primers using BigDye® Terminator v3.1 Cycle Sequencing Kit’s in 0.25 × 10 µl reactions and run on an Automated ABI3730 Sequencer (2011 Life Technologies). Raw chromatograms were edited in Sequencher v5.1 (2012 Gene Codes Corp.), complementary strands were aligned, and COI was inspected for proper translation, alignments were done using the MUSCLE option in Sequencher. Neighbor-joining (NJ) trees were generated in PAUP* v4.0b10 (Swofford, 2002) for the 16S and COI data separately, and of the combined data. Scale bars at bottom of each tree represent uncorrected p-distances. […]

Pipeline specifications

Software tools Sequencher, MUSCLE, PAUP*
Application Nucleotide sequence alignment