Computational protocol: Long distance movement of DIR1 and investigation of the role of DIR1-like during systemic acquired resistance in Arabidopsis

Similar protocols

Protocol publication

[…] Total RNA was extracted from Arabidopsis leaf tissue using Trizol (sigma) method followed by DNA removal using Turbo DNase Free (Ambion). First strand cDNA synthesis was performed using 2 μg of total RNA as template which was reverse transcribed into cDNA by MMLV (Life Science Technologies) using manufacturer instructions and diluted 3 fold in water before use. qRT-PCR was performed in a 10 ul reaction consisting of 2 ul of diluted cDNA, LuminoCT SYBR Green qPCR ready mix (Sigma) and 200 or 400nM of primer. The mixture was loaded into low profile optical 96-well plates. qRT-PCR was performed in the Bio-Rad CFX96 touch™ Real-Time PCR Detection System and analyzed using BioRad CFX manager 2.0 software. Gene specific primers were validated for specificity and efficiency using an 8 point standard curve and purified products were Sanger sequenced to confirm identity. Primer secondary structure was evaluated using mfold↓ (http://mfold.rna.albany.edu/). Primers used were 5′ TCGTGATAATGGCTATGTTGGTC 3′ and 5′ ACTGTTTGGGGAGAGCAGAAG 3′ for DIR1, 5′ AATAAAGAGGATAAAATGACAAGC 3′ and 5′ CTGGTAAGCATTCATTCAACTC 3′ for DIR1-like, 5′ TGTCCGCAAATCCCTAAAAG 3′ and 5′ CCAGGGAGCTTCAAGAACAG 3′ for 5FCL. Genevestigator was used to choose the 5FCL reference gene based on the transcript stability and a similar expression range to our genes of interest. All samples were analyzed in three biological and technical replicates. A no template control as well as a no reverse transcriptase control were run simultaneously with the samples. For absolute quantification, standard curves (# of template copies vs. CT plots) generated from known quantities of DNA templates were used to convert real-time qRT-PCR data into absolute (Lu et al., ). PCR generated templates were separated on an agarose gel and purified. Fluorometry (Promega QuantiFluor™ dsDNA system) was then used to determine the exact concentration in copies/μl of the templates. For each gene product a standard curve was constructed using a 10-fold serial dilution series ranging from 1 to 1 × 108 copies/μL of DNA template. Absolute values were then calculated using the standard curve equation of the line. To account for variations in starting RNA template these final absolute values in number of transcripts/ng of RNA were divided by the number of transcripts/ng of RNA of the reference gene 5FCL. [...] Coding sequence and amino acid sequences of DIR1 (AT5G48485) and DIR1-like (AT5G48490) were retrieved from The Arabidopsis Information Resource (http://www.arabidopsis.org). Sequences were compared using the EMBOSS pairwise alignment algorithm (http://www.ebi.ac.uk/emboss/align). Signal peptides were deduced using the SignalP 3.0 prediction server at www.cbs.dtu.dk/services/SignalP. A SWISS-MODEL homology model of DIR1-like was produced using the Lascombe et al. () DIR1-phosopholipid crystal structure as a template (Peitsch, ; Schwede et al., ; Arnold et al., ; Kiefer et al., ). The Swiss-pdf viewer 4.0.1 was used to compare the DIR1 structure and the DIR1-like protein model [http:/www.expasy.org/spdbv/] (Guex and Peitsch, ). [...] A rooted phylogenetic Maximum Likelihood tree of DIR1 and DIR1-like proteins was created using protein sequences lacking the divergent ER signal sequence. Signal P 4.0 was used to determine where the signal sequence cleavage site was located (Perterson et al., ). The sequences were aligned in MEGA 5 using Muscle (Tamura et al., ). The evolutionary history was inferred using the Maximum Likelihood method based on the Kimura 2-parameter (Kimura, ) model with discrete Gamma distribution using MEGA 5 (Tamura et al., ). 10,000 bootstrap replicates were conducted and percent bootstrap values were placed on the branches (Felsenstein, ). Branches were drawn to scale, measured in number of substitutions per site and were labeled by species name followed by TAIR gene number or Phytozome 8.0 accession. […]

Pipeline specifications

Software tools EMBOSS, SignalP, SWISS-MODEL, MEGA, MUSCLE
Databases TAIR ExPASy
Applications Phylogenetics, Protein structure analysis, Nucleotide sequence alignment
Organisms Arabidopsis thaliana
Chemicals Estrogens