Computational protocol: A Novel Erythromycin Resistance Plasmid from Bacillus Sp. Strain HS24, Isolated from the Marine Sponge Haliclona Simulans

Similar protocols

Protocol publication

[…] The near complete 16S rRNA gene sequence of Bacillus sp. HS24 (1441 nt) (GenBank JF803858) obtained with the primers 27f and HS24F2 (GTGAAATGCGTAGATATGTGG) (GATC Biotech AG, Germany) was compared with sequences in the Genbank nucleotide sequence database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) using BLASTn , . A Neighbour-joining phylogenetic tree was generated by analysing near complete 16S rRNA gene sequences of Bacillus sp. HS24 and strains of closely related Bacillus species. The tree was constructed using maximum composite likelihood and pairwise deletion. Percentage bootstrap values (>50% only) from 1000 re-samplings are indicated at each node. Bar, 5% estimated sequence divergence.The pBHS24B plasmid was sequenced as follows: pBHS24B DNA restricted with HindIII and EcoRI was cloned into the vector pUC18 and initial nucleotide sequences obtained with the M13 primers (GATC Biotech AG, Germany), as previously described for plasmid pBHS24 . The complete nucleotide sequence of the plasmid (GenBank KC991136) was subsequently determined by primer walking, using pBHS24B as a template. The sequencing data was manually assembled using Bioedit . Open reading frames (ORFs) were determined and annotated using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), and Basic Local Alignment Search Tool (BLAST) at NCBI . […]

Pipeline specifications

Software tools BLASTN, BioEdit, Open Reading Frame Finder
Application Phylogenetics
Chemicals Erythromycin