Computational protocol: Heterologous expression of ZjOMT from Zoysia japonica in Escherichia coli confers aluminum resistance through melatonin production

Similar protocols

Protocol publication

[…] Full-length cDNA sequence of ZjOMT was amplified using gene-specific primers ZjOMT-F: GGCACTGGGCCTGGACCAAGGATT and ZjOMT-R: CGCAGACTTAATATATACGAAGAAAC which were designed according to the Zoysia Genome Database (http://zoysia.kazusa.or.jp/). The PCR product was cloned into the pGEM-T (Promega, USA) and subsequently sequenced.CDS was predicted by DNAMAN 7 software (Lynnon Corporation). The domain of the deduced ZjOMT protein was analyzed using Conserved Domain Database (CDD) (https://www.ncbi.nlm.nih.gov/cdd). The theoretical pI and molecular weight were predicted by the ProtParam online software (http://web.expasy.org/protparam). […]

Pipeline specifications

Software tools DNAMAN, ProtParam
Databases CDD ExPASy Full Length cDNA
Application Protein physicochemical analysis
Organisms Escherichia coli
Chemicals Aluminum, Melatonin