Computational protocol: The defective seed5 (des5) mutant: effects on barley seed development and HvDek1, HvCr4, and HvSal1 gene regulation

Similar protocols

Protocol publication

[…] Cloning of the HvDek1 gene was done by screening a barley cDNA library with several primer pairs specific to the maize Dek1 cDNA (). A PCR fragment obtained this way was cloned into a pCR4-TOPO vector following the manufacturer's recommendations and used as a probe screening an Hv_MBa BAC library from barley (Hordeum vulgare cv. Morex), obtained from CUGI, Clemson University (https://www.genome.clemson.edu/cgibin/orders?page=serviceHome&;service=barc).Hybridization was performed according to protocols provided by CUGI. Positive hits were visualized by autoradiography, and clone identity was determined by using the filter layout and the duplication pattern code. Positive clones were obtained from CUGI and amplified in Luria Broth (LB) medium with chloramphenicol selection overnight. High quality BAC DNA was extracted using NucleoBond BAC100 kit (Macherey-Nagel, Duren, Germany). The first BAC DNA sequencing reaction was performed with an HvDek1 primer targeting the probed region, and full-length sequence was obtained by primer walking. The HvCr4 gene was cloned and sequenced from the same CUGI BAC library as HvDek1. Degenerate primers were used to obtain an initial cDNA sequence which served as a probe for the library, and primer walking was used to obtain the whole genomic sequence from the positive BAC clone. The genomic HvSal1 sequence was amplified using primers designed based on candidate barley EST sequences obtained from the databases. Amplified fragments were cloned into a pCR4-TOPO vector according to the manufacturer's recommendations, and were sequenced and aligned to make out the full coding region. All sequencing was done using the Big Dye 3.1 kit (Applied Biosystems, Foster City, CA) according to the manufacturer's recommendations, and automatic analysis was performed using ABI Prism 377 DNA Sequencher (Gene Codes Corporation, Ann Arbor, MI). Sequence editing, alignment, and interpretation were performed with the aid of Sequencher and Vector NTI 5 software (InforMax). Novel sequences were blasted against the public databases at ncbi.nih.gov, plantgdb.org (), and the HarvEST v1.59 barely EST database. The sequences were submitted with the following accession numbers: HvCr4, EU096088; HvDek1, EU096089; HvSal1, EU096087. [...] Plant material for real-time transcript analysis of HvCr4, HvDek1, and HvSal1 was taken from wt and des5 mutant seeds (20–30 DAP) in two independent biological replicates. Quantitative RT-PCR was performed with three subsamples from each biological replication, resulting in a total of six experimental units. Each biological sample was extracted from 4–6 seeds. 966 ng total RNA from each sample was reverse transcribed using the Superscript III kit and RNase H treatment (Invitrogen, Carlsbad, CA) according to the manufacturer's recommendations. The reverse transcribed cDNA mix was then diluted 50 times and 5 μl were used as template for each qRT-PCR reaction. Transcript levels were analysed using a 7500 Real-time PCR machine (Applied Biosystems, Foster City, CA). PCR reactions were performed using the Platinum SYBR Green qPCR SuperMix UDG with ROX kit (Invitrogen, Carlsbad, CA), in 25 μl reaction volumes, but otherwise following the manufacturer's recommendations. Cycling conditions were standard conditions according to the 7500 System software: 50 °C 2 min, 95 °C 10 s, and 45 cycles of 95 °C 15 s, and 60 °C 1 min. Primers (Invitrogen, Carlsbad, CA) were designed using Primer Express 1.5 (Applied Biosystems) or Primer3 (http://www-genome.wi.mit.edu/genome_software/other/primer3.html). All primers were used at a concentration of 200 nM, at which efficiency ranged from 83% to 94%. Target specificity of each primer was ensured using dissociation curve analysis after the real-time PCR program. Individual threshold cycles (Ct values) were located from 22 to 33 cycles. Relative transcript levels of HvCr4, HvDek1, and HvSal1 were determined using the Standard curve method according to the User Bulletin 2 (ABI PRISM sequence detection system; PE-Applied Biosystems). This method was chosen in order to account for the varying primer efficiencies. The relative values of steady-state gene expression in were normalized to ubiquitin, Mub1 (Acc. No. M60175), as the endogenous reference. Real-time primers were as follows: HvUb-F, CAAGTGCGGACTCACCTATG; HvUb-R, TCGCGATAGGTAAAAGAGCAG; HvDek1-F, TTATCCACCTGAAATGCGCTATT; HvDek1-R, TGGCAACCACCTGCACTGTA; HvSal1-F, GCAGATCTTCGACCTCAAGTTCA; HvSal1-R, CCTTGAGCTTCTGGTCCTTCTC; HvCr4-F, GACCAGCGGATCGAGTACAG; HvCr4-R, ACCGCAGACCATCTCCTATG. [...] Multiple sequence alignments of full-length protein sequences and phylogenetic analysis according to the Neighbor–Joining method were constructed using ClustalX (v.2.0.3; ). An unrooted radial phylogenetic tree was displayed using TreeView (v.1.6.6; ). Statistical confidence was calculated by bootstrap analysis based on 1000 reiterations, of which none of the values were below 630 (values not shown). GenBank accession numbers for proteins are HvDEK1; EU096089, ZmDEK1; AY061804, OsDEK1; AP004161, OJ1311_H06.4, AtDEK1; AC027034, BAC F7A10.23, HvSAL1; EU096087, AtSAL1 (At1g73030), AtSAL2 (At1g17730), ZmSAL1; NP_001105218, OsSAL1(NP_001058177), HvCR4; EU096088, ACR4; NP_191501, AtCRR1; NM_111813.3, AtCRR2; NM_129475.3, AtCRR3; NM_115453.2, AtCRK1; NM_124159.2, OsCR4; AB057787, OsCRR1; AL606452.2, OsCRR2; AP004584.3, OsCRR3; AC129720.2, OsCRR4; AC123524.2, ZmCR4; NP_001105395. […]

Pipeline specifications

Software tools Sequencher, Primer Express, Primer3
Applications WGS analysis, qPCR
Organisms Arabidopsis thaliana, Hordeum vulgare, Zea mays