Computational protocol: Novel SPG11 mutations in Asian kindreds and disruption of spatacsin function in the zebrafish

Similar protocols

Protocol publication

[…] Searching the zebrafish genome assembly (Zv7 release v48) for KIAA1840 orthologs identified an Ensembl gene (ENSDARG00000045968) on chromosome 25, within contig Zv7_scaffold2404.1, at position 317,067–343,586 kb. This gene encodes several overlapping predicted transcripts sharing homology with the 3′ region of human SPG11 cDNA (exons 25–40). To delineate the rest of the zebrafish gene, human cDNA sequence was queried against the zebrafish genome and EST databases using the TBLASTN algorithm. A predicted partial mRNA (XM_001346277), located within Zv7_NA7051.1-2, was identified exhibiting homology with human SPG11 exons 2–9. Using primer pairs JH37 (5′ TTCTTGTGGGAGGATGTGAG 3′) and JH42 (5′ CTCCGCTCAGCAGGACTCT 3′) and JH43 (5′ GCAGGTGAGCGTCTGATTTT 3′) and JH44 (5′ AGGAAGCTGTTGGTCTTGGA 3′), we generated partial cDNA fragments of 1,522 and 1,097 bp. Both PCR products were cloned into the pCRII-TOPO vector (Invitrogen, Paisley, UK) to create constructs pCR3′spg11 and pCR5′spg11. The central 4,575-bp portion (exons 9–33) was TA-cloned into the pGem-T Easy vector (Promega, Madison, WI, USA), by long-range RT-PCR with primers zSPG11ex7intF (5′ GTTCTTCATCCGGCTTCAGT 3′) and zSPG11ex34intR (5′ CGAACAATCCCTTCCAGATT 3′). All clones were verified using internal sequencing primers. Multiple sequence alignments were generated using MultAlin software [], and motif analysis was performed with QuasiMotiFinder []. […]

Pipeline specifications

Software tools TBLASTN, MultAlin, QuasiMotiFinder
Applications Protein sequence analysis, Amino acid sequence alignment
Organisms Danio rerio
Diseases Central Nervous System Diseases, Spastic Paraplegia, Hereditary