Similar protocols

Pipeline publication

[…] GTA,, Negative control region reverse: CCATGGAACTGGGACCTTCTTC, FACS-isolated cells and cultured cells were directly lysed into TRIzol LS (Invitrogen, Carlsbad, CA). Total RNA was purified using the Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA) per manufacturer’s instructions. For RNA-Seq, quality of the RNA for sequencing was determined using an Agilent 2100 Bioanalyzer; all samples used had RNA integrity numbers >9. Library preparation using the Illumina TrueSeq mRNA sample preparation kit was performed at the Weill Cornell Medical College Genomic Core facility (New York, NY), and RNAs were single-end sequenced on Illumina HiSeq 2000 machines. Alignment of reads was done using Tophat with the mm9 build of the mouse genome. Transcript assembly and differential expression was determined using Cufflinks with Refseq mRNAs to guide assembly (). Analysis of RNA-seq data was done using the cummeRbund package in R (). For real-time qRT-PCR, equivalent amounts of RNA were reverse-transcribed by SuperScript VILO cDNA Synthesis Kit (Life Technologies). cDNAs were normalized to equal amounts using primers against Ppib2, Hprt, or Gapdh. cDNAs were mixed with indicated primers and SYBR green PCR Master Mix (Sigma), and qRT-PCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR system. The following primer sequences were used (5’ to 3’):, mPpib2 forward: GTGAGCGCTTCCCAGATGAGA,, mPpib2 reverse: TGCCGGAGTCGACAATGATG, mHprt forward: GATCAGTCAACGGGGGACATAAA,, mHprt reverse: CTTGCGCTCATCTTAGGCTTTGT, mGapdh forward: GTCGTGGAGTCTACTGGTGTCTTCAC,, mGapdh reverse: GTTGTCATATTTCTCG […]

Pipeline specifications

Software tools TopHat, Cufflinks, CummeRbund
Diseases Neoplasms, Glandular and Epithelial, Neoplasms, Neoplasms, Glandular and Epithelial