Computational protocol: Septins of Platyhelminths: Identification, Phylogeny, Expression and Localization among Developmental Stages of Schistosoma mansoni

Similar protocols

Protocol publication

[…] Coding regions deduced in the genome of Schistosoma mansoni , were used as a database to identify septin genes through the tBLASTn program, using all human septins as queries. Four putative orthologues of septin were identified: Smp_041060, Smp_060070, Smp_003620 and Smp_029890. The multiple sequence alignment of the GTPase domain from these four S. mansoni septins with septins from Homo sapiens, Caenorhabditis elegans, Drosophila melanogaster, Strongylocentrotus purpuratus and Ciona intestinalis was accomplished using ClustalX2 . Additional alignment was performed with GTPases domains from several platyhelminths using the same approach. Phylogenetic analyses were performed using a Bayesian inference method implemented in MrBayes (v3.1.2) . All analyses were run using default parameters, except by the use of the command “prset aamodelpr = mixed”, which allows the use of a mixture of amino acid models with fixed rate to estimate the appropriate model for the analysis. Analyses were stopped after 1,000,000 generations, with samplings every one hundredth generation. Tree information was summarized utilizing the “sumt burnin = 2500”, which discards the first 250,000 generations. In all cases, the measured potential scale reduction factor (PSRF), obtained using the “sump burnin = 2500” command, was equal to 1, indicating a convergence of the analysis. Amino acids models chosen by the program for each tree were: Tree 1 (, ), WAG (posterior probability = 1.0); Tree 2 (), WAG (posterior probability = 0.877) and Jones (posterior probability = 0.123). The resulting tree together containing the posterior probability for each branch was visualized using TreeView . [...] Total RNA was recovered from developmental stages of schistosomes using the RNAqueous-4PCR system (Ambion). Any residual DNA in the RNA was removed by digestion with DNase (TurboDNase, Ambion). RNA concentration, purity and integrity were determined by Nanodrop 1000 spectrophotometer and Agilent 2100 Bioanalyzer; cDNA was synthesized from 150 ng RNA using the iScript cDNA Synthesis Kit (Bio-Rad). Quantitative polymerase chain reaction (qPCR) employing iQ SYBR Green Supermix (Bio-Rad), each primer at 0.3 µM in 20 µl reaction volume, was performed in a thermocycler (iCycler, Bio-Rad) fitted with real time detector (Bio-Rad iQ5). Septins-specific primers that spanned predicted exon junctions were designed as follows: SmSept5 forward primer, 5′-GGAACTGGCTTTGAGGCTATTG-3′; SmSept5 reverse primer, 5′-TGTTCTTGCATTTTACTCATTAGTTGTTG-3′; SmSept10 forward primer, 5′-CGACGTCAACGCTTAATCGA-3′; SmSept10 reverse primer 5′-CTTTAACACGCTGAACAAACATTTG-3′; SmSept7.1 forward primer, 5′-GGGTTTTGTGTTCAATCTTATGATTACT-3′; SmSept7.1 reverse primer, 5′- GATGGACCAGGATAATCAGTGTTG-3′, SmSept7.2 forward primer 5′-CGCGTTTCGATGATTACATATCTG-3′; SmSept7.2 reverse primer 5′- GGAGCAATAAAGTAAATGCATGCA - 3′. Efficiency of the PCR for each pair of septin specific primers was estimated by titration analysis to be 100%±5 (not shown).The qPCRs were performed in triplicate followed an initial denaturation at 95°C for 3 min and 40 cycles of 30 sec at 95°C and 30 sec of 55°C. The specificity of the PCR product was verified by a melting curve: 1 min at 95°C, 1 min at 55°C and a ramp from 55 to 95°C with an increasing rate of 1°C/min. Absolute quantification was undertaken using copy number standards, i.e. 10-fold serial dilutions of each septin clone. Copy number of each clone dilution was calculated through the relationship between the molecular mass of the clone and the Avogadro constant. Absolute copy number of septin transcripts was estimated by interpolation of the sample PCR signals from a standard curve . Biological replicates were performed. In addition, relative quantification was undertaken in order to evaluate the expression of the four septin genes within developmental stages of S. mansoni. S. mansoni glyceraldehyde 3-phosphate dehydrogenase (SmGAPDH; GenBank M92359), forward primer, 5′-TGTGAAAGAGATCCAGCAAAC-3′; reverse primer, 5′-GATATTACCTGAGCTTTATCAATGG-3′ was employed as a reference gene, with these PCRs carried out as above. The E−ΔCt method, a variation of the Livak method that incorporates the amplification efficiency values (E) for each pair of primers, was employed to determine the expression of septins relative to SmGAPDH, within each sample, i.e. each developmental stage analyzed . Bioinformatics analyses were performed using RNA-seq reads from libraries of adult worms and of cercariae . A tally of the RNA-seq reads aligning to the transcripts encoding the four septins was compiled based on outcomes of a blastn search, to assess relative abundance of each septin. […]

Pipeline specifications

Software tools TBLASTN, Clustal W, MrBayes, TreeViewX, BLASTN
Applications Phylogenetics, RNA-seq analysis, Amino acid sequence alignment
Organisms Saccharomyces cerevisiae, Homo sapiens, Schistosoma mansoni