Computational protocol: The IL-33-PIN1-IRAK-M axis is critical for type 2 immunity in IL-33-induced allergic airway inflammation

Similar protocols

Protocol publication

[…] Gene expression was assessed using Affymetrix (Santa Clara, CA) GeneChip Mouse Genome 430 2.0 arrays. 15 μg cRNA was fragmented and hybridized to arrays’ according to the manufacturer’s protocols. The quality of scanned array images were determined on the basis of background values, percent present calls, scaling factors, and 3’/5’ ratio of β-actin and GAPDH. Data were extracted from CEL files and normalized using RMAexpress (http://rmaexpress.bmbolstad.com/) and annotated using MeV software (http://www.tm4.org/mev.html). Differentially expressed genes between different conditions were determined using a fold change threshold of 2. [...] Validation of differentially expressed genes was performed by RT-PCR. 200 ng of high quality RNA samples were reverse transcribed to first strand cDNA and 1 μl cDNA was used for each RT-PCR reaction. Samples were performed in triplicates. SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) was used for two-step real-time RT-PCR analysis on an Applied Biosystems StepOnePlus Real Time PCR instrument. Primers’ sequences were designed using the rpimer3 tool (http://bioinfo.ut.ee/primer3-0.4.0/primer3/). Expression value of the targeted gene in a given sample was normalized to the corresponding expression of Actin. The 2–ΔΔCt method was used to calculate relative expression of the targeted genes. The primer sequences are as fallow: mCxcl2 forward: CACTCTCAAGGGCGGTCAAA; mCxcl2 reverse; CAGGTCAGTTAGCCTTGCCT; mCcl5 forward; GCAGTCGTGTTTGTCACTCG; mCcl5 reverse: GCAAGCAATGACAGGGAAGC; mActin forward: ACACCCGCCACCAGTTCG; mActin reverse: CCACGATGGAGGGGAATACAG; mCsf3 forward: CGTTCCCCTGGTCACTGTC; mCsf3 reverse: TAGGTGGCACACAACTGCTC; mIl6 forward: CACGGCCTTCCCTACTTCAC: mIl6 reverse: GGTCTGTTGGGAGTGGTATCC; hIl6 forward: TCAATATTAGAGTCTCAACCCCCA; hIl6 reverse: TTCTCTTTCGTTCCCGGTGG; hCxcl2 forward: GGCATACTGCCTTGTTTAATGT; hCxcl2 reverse: TCTCTGCTCTAACACAGAGGGA; hCcl5 forward: CAGTCGTCTTTGTCACCCGA; hCcl5 reverse: TCTTCTCTGGGTTGGCACAC; hActin forward: CCGTTCCGAAAGTTGCCTTTT; hActin reverse: CCGCTGGGTTTTATAGGGCG; hCsf3 forward: GAGGAAGATCCAGGGCGATG; hCsf3 reverse: AGCTTGTAGGTGGCACACTC. [...] All NMR spectra were recorded at 25 °C on a Varian Inova 600 MHz spectrometer equipped with a 1H/13C/15N triple resonance probe with Z-axis gradient. The 15N- labeled PIN1 WW domain (PIN1 residues 1-50) was expressed and purified. The PIN1 gene was inserted into a pET28 vector with Kanamycin resistance as a fusion protein with an N-terminal His6-tag separated by a TEV cleavage site. Full length PIN1 was expressed in LB culture. The cells were induced at OD600 of 0.6~0.8 by adding 1 mM of final concentration of IPTG at 16 °C for 20 h Cells were harvested by centrifugation at 3500 g, and the cell pellet was dissolved in PIN1 wash buffer (50 mM Phosphate, 300 mM NaCl, 20 mM Imidazol, and 0.1 mM TCEP, pH 8.0). Lysozyme was added to dissolved cells, and sonicated on ice for 1 min in 50% pulses and repeated 4 times. Cell debris was removed by centrifugation, and supernatant was incubated in a column with 2 mL Ni-NTA agarose (QIAGEN) pre-equilibrated with wash buffer. The column was washed with 4 bed volumes of PIN1 wash buffer, and His6-tag PIN1 was eluted with 4 bed volumes of elution buffer (300 mM of imidazole added to PIN1 wash buffer). Synthetic peptides IRAK-M-pS110 (comprised of IRAK-M residues 103-124 with Ser110 phosphorylated, TNYGAVL(pS)PSEKSYQEGGFPNI), and IRAK-M-S110E (IRAK-M residues 103-124 with the S110E substitution), were purchased from Tufts University, Core Facility, Boston, MA.The IRAK-M[1–119] gene was encoded into the pMAL-c2X vector with N-terminal fusion partner MBP, separated by a Factor XA cleavage site. The R56D and Y61D mutations were achieved using this vector, a single primer (forward primer, with mutations underlined: 5’ AGC AGC TGG CTG GAT GTT GAT CAT ATT GAA AAG GAT GTA GAC CAA GGT AAA AGT G 3’) and the BIO RAD-iProof High-Fidelity DNA Polymerase to generate expression plasmid pMAL-c2X encoding the MBP- IRAK-M[1-119:R56D,Y61D] fusion protein, with a Factor XA cut site between MBP and IRAK-M[1-119:R56D,Y61D]. To produce uniformly 15N-labeled MBP-IRAK-M[1-119:R56D,Y61D] in E. coli, transformed cells were grown in M9 minimal media with 15NH4Cl as the sole nitrogen source, and were induced at OD600 by adding 0.4 mM final concentration of IPTG at 25 °C for 20~22 h. Cells were harvested by centrifugation at 3500 g, the cell pellet was dissolved in IRAK-M wash buffer (20 mM Tris, 200 mM NaCl, 1 mM EDTA, and 0.2 mM TCEP, pH 7.4), and sonicated on ice. Cell debris was removed by centrifugation, the supernatant was incubated with 5 mL of Amylose Resin (BioLabs) pre-equilibrated with IRAK-M wash buffer. The column was washed with 4 bed volumes of IRAK-M wash buffer, and the fusion protein was eluted with 2 bed volumes of elution buffer (10 mM of Maltose added to IRAK-M wash buffer). Eluted fusion protein was dialyzed into Factor XA cleavage buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM CaCl2, pH = 8.0). Factor XA was added (50ul of 1ug/ul to 10 ml of fusion protein) and the solution was gently rocked at room temperature overnight. The cut protein products were concentrated to 2~3 ml, dialyzed into FPLC buffer (10 mM Tris, 20 mM NaCl, and 0.2 mM TCEP, pH 8.0) and loaded onto a size exclusion FPLC column (BioRad). Eluted fractions containing IRAK-M[1-119:R56D,Y61D] were pooled, concentrated, and TCEP was added to a total concentration of 2 mM. The pH was adjusted to 6.65 using 0.1 M HCl. IRAK-M[1-119:R56D,Y61D] concentration was measured by UV absorption at 280 nm (extinction coefficient = 25105 cm-1 M-1). Purity was verified by SDS-PAGE.Nuclear magnetic resonance (NMR) experiments were performed on a Varian Inova 600-MHz spectrometer at 25 °C. NMR spectra were processed and analyzed using NMRPipe and Sparky software; T. D. Goddard and D. G. Kneller, SPARKY 3, University of California, San Francisco). The composite chemical shift change in the 2D 1H -15N HSQC was monitored during NMR titration experiments and was fit to the standard bimolecular binding equation. Fitting of the data to the standard bimolecular binding equation was achieved using Excel and the Solver Add-in (Microsoft).To quantify the binding affinity between the PIN1 WW domain and peptides, the 15N labeled PIN1 WW domain was titrated with the each of the synthetic peptides, IRAK-M-pS110 and IRAK-M-S110E. A reverse titration method was used, where the 15N labeled protein was mixed with a high concentration synthetic peptide for the first sample. Subsequent samples were a serial dilution of this sample with one part derived from the previous sample and one part from a stock solution of the 15N labeled PIN1 WW domain at the same concentration as the 15N labeled PIN1 WW domain in the first sample. This resulted in a titration where the concentration of the15N PIN1 WW domain was constant, and the concentration of synthetic peptide decreased by a factor of 0.5 in each successive sample. For each of the IRAK-M-pS110 and IRAK-M-S110E peptides, a 1H -15N HSQC of 15N-PIN1-WW at each titration point was acquired on a Varian Inova 600-MHz spectrometer at 25 °C, and the resulting chemical shift perturbations were used to determine the KD value as described above.For the quantification of PIN1 isomerization of peptides IRAK-M-pS110 and IRAK-M- S110E, homonuclear 2D rotating-frame overhauser effect spectroscopy (ROESY) NMR experiments were performed. For PIN1 catalysis of IRAK-M-pS110, 13.8 µM of PIN1 was added to 4.44 mM of peptide, and ROESY experiments were acquired with 0 ms, 4 ms, 8 ms, 20 ms, 40 ms, 60 ms, 80 ms, 100 ms, and 150 ms mixing times. For PIN1 catalysis of IRAK-M-S110E, 20 µM of PIN1 was added to 4.18 mM of peptide, and ROESY experiments were acquired with 0 ms, 16 ms, 20 ms, 40 ms, 60 ms, 80 ms, 100 ms, and 150 ms mixing times. For the appropriate controls, each of IRAK-M-pS110 and IRAK-M-S110E were detected by ROESY without PIN1. The ratios trans to cis were measured by Total Correlation Spectroscopy (TOCSY) for both peptides. The intensity ratios of cross peaks to diagonal peaks for cis and trans conformation in the ROESY spectra were fit using Equations  – :1Icc(tm)=Icc(0){-λ2-a11e-λ1tm+λ1-a11e-λ2tm}λ1-λ22Itt(tm)=Itt(0){-λ2-a22e-λ1tm+λ1-a22e-λ2tm}λ1-λ23Ict(tm)=Icc(0){a21e-λ1tm-a21e-λ2tm}λ1-λ24Itc(tm)=Itt(0){a12e-λ1tm-a12e-λ2tm}λ1-λ25λ1,2=1∕2{(a11+a22)±(a11-a22)2+4kctcatktccat}6a11=kctcat+R2,c,a22=ktccat+R2,t,a12=-ktccat,a21=-kctcatwhere R2,c and R2,t are the transverse relaxation rates of magnetization in cis and trans, tm is the mixing time, kctcat and ktccat represent the exchange rates between cis and trans, and Icc(0) and Itt(0) are the diagonal peak intensities of the cis and trans at states at time tm=0.Homology modeling of the IRAK-M death domain sequence was performed using Swiss-Model. From the several potential template structures available, an IRAK-2 death domain subunit within the Myddosome assembly structure (3mop.pdb, Chain L) was chosen for modeling to provide insight regarding interaction interfaces. The resulting homology model was energy minimized, and then aligned with IRAK-2 subunits in the Myddosome structure (3mop.pdb) using DeepView. [...] A 15N IRAK-M[1-119:R56D,Y61E] sample was used to collect 2D 15N-1H HSQC spectra and 3D 1H-15N NOESY and 1H-15N TOCSY spectra. A 13C/15N double labeled sample was used to collect 1H-15N HSQC, HNCA, HN(CO)CA, HNCO, HN(CA)CO, CBCANH, CBCA(CO)NH, H(CCO)NH, C(CO)NH, HCCH-TOCSY, 1H-13C aliphatic NOESY, and 1H-13C aromatic NOESY spectra. Backbone assignments were obtained from 1H-15N HSQC, 1H-15N NOESY, 1H-15N TOCSY, HNCA, HN(CO)CA, HNCO, HN(CA)CO, CBCANH, CBCA(CO)NH, H(CCO)NH, C(CO)NH, and HCCH-TOCSY spectra. Aromatic ring resonances were assigned using the 1H-15N NOESY, 1H-13C aliphatic NOESY, and 1H-13C aromatic NOESY spectra. Carbonyl resonances were assigned using the HNCO spectrum.Resonance assignments were obtained using PINE imbedded in NMRFAM-SPARKY and were adjusted manually. The assigned residue numbers are five added to the original IRAK-M residue numbering due to the non-native 5 residues at the N-terminus that remain after cleaving MBP.The resulting chemical shift assignments and NOESY data were used for solving the IRAK-M[1-119:R56D,Y61E] structure (RCSB Protein Data Bank ID 5UKE). Chemical shifts and three sets of raw NOESY spectra in ‘.ucsf’ format were submitted to Ponderosa Client (http://ponderosa.nmrfam.wisc.edu/), and Ponderosa Analyzer was used to interatively refine and validate the resulting structural ensemble. Ponderosa uses CYANA automation and XPLOR-NIH–. […]

Pipeline specifications

Software tools Sparky, SWISS-MODEL, Swiss-PdbViewer, NMRFAM-SPARKY, Xplor-NIH
Applications NMR-based proteomics analysis, Protein structure analysis
Diseases Asthma, Drug Hypersensitivity