Computational protocol: Mansonella ozzardi mitogenome and pseudogene characterisation provides new perspectives on filarial parasite systematics and CO-1 barcoding

Similar protocols

Protocol publication

[…] A single microfilarial DNA extract (containing a pool of microfilariae) obtained from a single blood collection taken from a single Tefé resident that tested positive for M. ozzardi (and no other filarial parasite) in both light-microscopy and PCR testing, was selected for M. ozzardi mitogenome characterisation. Shot-gun DNA sequencing of this DNA extract was performed on an Illumina HiSeq 2500 system (Oswaldo Cruz Foundation, high-throughput sequencing platform) using 2 × 100 nucleotide paired-end reads generated with Nextera Truseq libraries. Reads corresponding to human-host DNA were filtered out by mapping them against a human reference genome (accession number: GCA_000001405.19). The M. ozzardi mitogenome was assembled with the A5-miseq pipeline. Mapping and short read post-processing was performed using Bowtie2 software and Samtools utilities, respectively. The prediction of protein-coding genes, rRNAs and tRNAs was done using MITOS and Arwen software and validated manually by comparing homologous regions with a Loa loa mitochondria reference in Artemis. A mitogenome map was generated using the BRIG software package. [...] A provisional mitogenome nucleotide sequence assembly was aligned to a set of 21 previously published nematode mitogenome sequences using CLUSTAL X (See supplementary information, Fig. ). This identified an anomalous region in our provisional mitogenome assembly which was PCR amplified using primers designed from one conserved part of the NADH dehydrogenase subunit 2 gene (NADHDS2: TGAATGTGGTTTTGTTGTTCCT) and one conserved part of the NADH dehydrogenase subunit 5 gene (NADHDS5: GGGCTGCTATAGCCTTTGGT). Amplification was performed with a PCR reaction mix containing: 0.5 µl of each primer at a concentration of 100 mM, 5 µl of M. ozzardi DNA extract and 16.5 µl of PCR master mix in a 50 µl reaction mix, topped-up with 27.5 µl ultrapure sterilised water. The chemical composition of the PCR master mix was: 10 µl of 5 × Promega GoTaq PCR buffer; 4 µl of MgCl2 at a concentration of 25 mM and 1 µl of a DNTP mix, containing each DNTP at a concentration of 10 mM, and 1.5 µl of promega GoTaq at a concentration of 5Uµl-1. PCR amplification used the following cycling conditions: 95 °C for 2 minutes followed by 5 cycles of: 95 °C for 1 minute then 58–68 °C for 1 minute then 72 °C for 1 minute and 30 seconds; followed by 40 cycles of: 95 °C for 1 minute then 58 °C for 1 minute then 72 °C for 1 minute and 30 seconds. The protocol was completed with a final extension step of 72 °C for 10 minutes. Amplified PCR products were Sanger sequenced in both directions using the forward and reverse NADHDS2 NADHDS5 primers used to amplify them as well as a set of internal primers: TGTGGTTTTGTTGTTCCTAGTTT and AAAACCCAATCACAGACAATGAA. Prior to sequencing, the amplicons were cleaned-up using a Promega wizard PCR kit and protocol. Sequencing was done with an Applied Biosystems BigDye Terminator kit and ABI PRISM® 3100 Genetic Analyzer.Figure 1 [...] DNA and conceptually translated amino acid sequences obtained for this study were aligned with sequences downloaded from GenBank using the program Clustal X 2.0. Sequence alignment editing was done in GenDoc. Phylogenetic analysis was performed using software from the PHYLIP package (version 3.67). Because analysis of a similar set of filarial parasite mitogenomes found evidence that variation in the third codon base position of mitochondrial protein coding regions had reached saturation (see Yilmaz et al.), our whole mitogenome tree construction was done using an alignment of conceptually translated amino acid sequence concatemers and the Maximum likelihood tree-building program “proml” of Felsenstein. The mitogenome alignment used for this tree was prepared with 22 mitogenome sequences and all 12 mitochondrial protein codon gene sequences (see supplementary information, Fig. ). In order to make our phylogenetic analysis easily comparable with previous analysis of Yilmaz et al. we used mitogenome sequences from all of the species that they used in their analysis and thus have included mitogenome sequences from two nematode species that are not from the filarial worm taxa Onchocercidae. Yilmaz et al. used Ascris lumbricoides and Dracunculus medinensis mitogenome sequences as outgroups in the construction of their phylogenetic tree and so we have also included these non-Onchocercidae nematode-origin sequences in our analysis. Maximum likelihood trees from partial mitochondrial CO1 and 12 S sequences were prepared using nucleotide-level alignments and the PHYLIP program “dnaml”, as was the nuclear 5 S ribosomal tree. The robustness of all four tree topologies was tested with 1,000 bootstrap pseudo replicate alignments that were generated with the PHYLIP program “seqboot”. […]

Pipeline specifications

Software tools A5, Bowtie2, SAMtools, MITOS, ARWEN, Artemis, BRIG, Clustal W, PHYLIP
Applications Genome annotation, Phylogenetics, Genome data visualization
Organisms Toxoplasma gondii
Diseases Parasitic Diseases