Computational protocol: Mungo bean sprout microbiome and changes associated with culture based enrichment protocols used in detection of Gram-negative foodborne pathogens

Similar protocols

Protocol publication

[…] Bacterial community composition of the samples was assessed by sequencing amplicons of the 16S rRNA gene. Sequencing was performed at GATC (Konstanz, Germany) based on their 300-bp paired-end protocol (https://www.gatc-biotech.com/de/produkte/inview.applikationen/inview-microbiome.html). Briefly, 471-bp fragments of the variable regions V1–V3 of the 16R rRNA gene in the samples were amplified using the primer pair 27F (AGAGTTTGATCCTGGCTCAG) and 534R (ATTACCGCGGCTGCTGG) and subjected to Illumina sequencing. Resulting 16S rRNA gene amplicons were quality filtered and merged based on overlapping bases using FLASh with maximum density of 0.25 []. The aligned merged filtered sequences were clustered into operational taxonomic units (OTUs) defined by 97 % similarity. The taxonomic status of the generated OTU clusters was assigned by BLAST against non-redundant 16S rRNA reference sequences obtained from the Ribosomal Database Project (RDP Release 11 updated September 2014) [, ]. The Shannon and Simpson diversities of the samples were calculated using the R package Vegan (http://cc.oulu.fi/~jarioksa/softhelp/vegan/html/diversity.html). Venn diagrams were constructed using Venny (http://bioinfogp.cnb.csic.es/tools/venny/index.html). The ß diversity between the non-enriched and enriched mungo bean sprout microbiomes was estimated using UniFrac and Bray-Curtis dissimilarity analysis implemented in CLC genomics Workbench (QIAGEN, Prismet, Denmark). Metastats, which is based on a nonparametric t test, Fisher’s exact test, and the false-discovery rate was used to determine OTUs that were statistically significantly different when groups were compared (P ≤ 0.05) []. […]

Pipeline specifications

Software tools VENNY, CLC Genomics Workbench
Application 16S rRNA-seq analysis
Organisms Escherichia coli