Computational protocol: Exploring the Cultivable Ectocarpus Microbiome

Similar protocols

Protocol publication

[…] To identify bacterial isolates, single colonies were grown in the corresponding liquid growth media until maximal density was reached. Approximately 50–100 μl of cultures were heated for 15 min at 95°C. Then the 16S rRNA gene was amplified using universal primers (8F 5′ AGAGTTTGATCCTGGCTCAG and 1492R 5′ GGTTACCTTGTTACGACTT from ) and the GoTaq polymerase in a PCR reaction with the following amplification conditions: 2 min 95°C; [1 min 95°C; 30 s 53°C; 3 min 72°C] 30 cycles; 5 min 72°C. In some cases a commercial kit was used to extract DNA (NucleoSpin® Tissue, Machery-Nagel; support protocol for bacteria). The PCR products were purified using ExoSAP (Affymetrix, Inc., Thermo Fisher Scientific) and sequenced with Sanger technology (BigDye Xterminator v3.1 cycle sequencing kit, Applied Biosystems®, Thermo Fisher Scientific). Only the forward primer 8F was used for the sequencing reaction. For classification and analyses of the sequences, RDP classifier () and BLAST against the NCBI nr and 16S rRNA gene databases were used and sequences classified at the genus level if possible. Sequences were aligned and checked manually to verify mismatches and to identify distinct strains within a genus (>99% identity). The 16S rRNA gene sequences from each distinct cultivable strain were aligned using MAFFT version 7 () and the G-INS-i algorithm. Only well-aligned positions with less than 5% alignment gaps (492 positions) were retained. Phylogenetic trees were reconstructed using the Maximum-Likelihood method implemented in MEGA6.06 (), and the GTR+G+I model. Five hundred bootstrap replicates were tested to assess the robustness of the tree. The unique 16S rRNA gene sequences were submitted to the European Molecular Biology Laboratory (EMBL) database and are available under project accession number PRJEB22665. Stocks of bacterial isolates were preserved in 40% glycerol at -80°C.The numbers of sequences obtained per taxa were normalized against the total number of sequences obtained within the complete cultivation study. To assess cultivation biases statistically, the absolute abundances of cultivable isolates were analyzed in R () with the Fisher-exact test and Bonferroni post hoc correction for multiple testing (α = 0.05, significant if p < 0.0011). [...] To estimate the proportion of cultivable bacteria in our algal cultures, the collection of bacterial isolates was compared with 16S rRNA gene libraries from the same algal culture used for our isolation experiments. These libraries served as a reference to assess the total microbiome, including cultivated and non-cultivated bacteria; they were not used to infer diversity per se. EC371 cultures were grown for 9 weeks in seawater-based culture medium (changed on a monthly basis, last 1 week prior to sampling). Algal tissue was filtered with sterile coffee filters, dried on a paper-towel, and snap-frozen in liquid nitrogen. Four technical replicates were pooled two by two. Total DNA was isolated (NucleoSpin® Plant II, Machery-Nagel; standard protocol) and purified with Clontech CHROMA SPINTM-1000+DEPC-H2O Columns. The V3–V4 region of the 16S rRNA gene was amplified and sequenced with Illumina MiSeq technology by MWG Eurofins Biotech (Ebersberg, Germany) using their proprietary protocol. The first preliminary quality control was done with FastQC, and fastq_quality_trimmer from the FASTX Toolkit was used to quality-trim and filter the 568,100 reads (quality threshold 25; minimum read length 200). The resulting 553,896 sequences (2.5% removed) were analyzed with Mothur (V.1.38.0) according to the MiSeq Standard Operating Procedures (). Filtered reads were assembled into 270,522 contigs, preclustered (allowing for four mismatches), and aligned with the non-redundant Silva SSU reference database version 123 (). Chimeric sequences were removed using the Uchime algorithm () implemented in Mothur, and the remaining sequences classified taxonomically using the method of . Non-bacterial sequences were removed. The sequences were then clustered into operational taxonomic units (OTUs) at a 97% identity level and each OTU was classified taxonomically. All OTUs with n ≤ 5 sequences were removed (0.02%) resulting in a final data matrix with 217,923 sequences. The sequences obtained from cultivable isolates were compared with the 16S rRNA gene metabarcoding data using BLASTn searches against raw reads (99% identity) and consensus OTU sequences (97% identity). In addition, the current dataset (META2016-NSW) was compared to previous datasets (META2013-NSW, META2013-DNSW) obtained from the same algal strain 3 years earlier (). All counts for each individual OTU were normalized against the total number of sequences in the corresponding dataset. Raw Illumina reads were deposited at the European Nucleotide Archive under project accession number PRJEB22665. To compare the cultivable sequences and their abundance in the 16S metabarcoding data (META13-NSW and META16-NSW) a heatmap was created using the iTOL web application (). Log(x+1)-transformed data was used for OTU sequence counts and cultivation abundances. All datasets (three for metabarcoding, 10 for cultivation) were grouped by hierarchical clustering using Euclidean distance calculations and the average linkage method implemented in the pvclust R-package (). The resulting tree was tested using bootstrap analysis (500 replications). OTUs that did not correspond to cultivable strains are not shown in the graphical representation. In this manuscript, “isolate” refers to every bacterial culture for which a 16S rRNA sequence was obtained. All isolates with identical 16S rRNA sequences are considered to belong to the same “strain”. […]

Pipeline specifications

Software tools RDP Classifier, MAFFT, MEGA, FastQC, mothur, UCHIME, BLASTN, iTOL, Pvclust
Databases ENA
Applications Phylogenetics, 16S rRNA-seq analysis
Organisms Escherichia coli, Bacteria
Diseases Byssinosis