Computational protocol: LXRα and LXRβ Nuclear Receptors Evolved in the Common Ancestor of Gnathostomes

Similar protocols

Protocol publication

[…] Amino acid sequences were retrieved through BLAST searches in the publically available genome databases (Ensembl, GenBank, Skatebase; http://skatebase.org/), using as reference annotated human LXRα and LXRβ sequences. Sequence sampling included representatives of major vertebrate lineages: mammals (Homo sapiens, Pan troglodytes, Mus musculus, Cavia porcellus, Dasypus novemcinctus, Oryctolagus cuniculus), reptiles (Thamnophis sirtalis, Python bivittatus, Anolis carolinensis, Alligator mississippiensis, Alligator sinensis) birds (G. gallus, Meleagris gallopavo, Ficedula albicollis, Taeniopygia guttata, Anas platyrhynchos), amphibians (X.laevis, X. tropicalis), sarcopterygii (Latimeria chalumnae), euteleostei (Takifugu rubripes, Siganus canaliculatus, Oryzias latipes, Oreochromis niloticus, D. rerio) osteoglossomorpha (Scleropages formosus), holostei (Lepisosteus oculatus), chondrichthyans (L. erinacea, S. canicula, Callorhinchus milii), cyclostomes (L. japonicum and P. marinus) and four invertebrate deuterostomes (Ciona intestinalis, Branchiostoma lanceolatum, B. floridae and Saccoglossus kowalevskii). Retrieved sequences and corresponding accession numbers are listed in the Supplementary Material online. All sequences were aligned with MAFFT alignment software () using the E-INS-i model. Sequence alignment was visualized and edited in Geneious® v7.1.7 (available upon request). The columns containing 90% of gaps were stripped. The final sequence alignment contained 86 sequences and 547 positions and was used to perform phylogenetic analysis. Bayesian phylogenetic calculation was performed with MrBayes v 3.2.3 sited in the CIPRES Science Gateway V3.3 (). Calculation parameters were as follows, generation number = 1000000, rate matrix for aa = mixed (Jones), nruns = 2, nchains = 4, temp = 0.2, sampling set to 500 and burnin to 0.25. LXRα and LXRβ genes were localized onto the human chromosomes Chr11 and Chr19, respectively, corresponding LXR gene and the neighboring genes were collected from Ensembl and GenBank databases. Human loci (GRCh38) were further used as a reference to assemble the synteny maps of the remaining species: G. gallus (Galgal4), A. carolinensis (AnoCar2.0), X. tropicalis (GCF_000004195.3), X. laevis (GCF_001663975.1), L. chalumnae (LatCha1), D. rerio (GRCz10), L. oculatus (LepOcu1), B. floridae (GCF_000003815.1) and B. lanceolatum (BraLan2). Synteny statistics was calculated using CHSminer v1.1 () search parameters were maintained as default: maximal gap ≤ 30 and size ≥ 2, with the exception of the D. rerio Ch7 versus H. sapiens Chr11, were maximal gap was set to 80 to accommodate the highly rearranged locus in D. rerio. Leucoraja erinacea were collected from the coast of Woods Hole, MA. All tissues were collected and preserved in RNAlater and stored at −20 °C. Total RNA was isolated using an Illustra RNAspin Mini RNA Isolation Kit (GE Healthcare, UK) according to the manufacturer’s recommendations, including the on-column treatment of isolated RNA with RNase-free DNase I. Using 500ng of liver RNA as input cDNA was synthetized with the iScript cDNA Synthesis Kit (Bio-Rad), according to the manufacturers’ recommendations. Using two partial LXRα-like segments retrieved through BLAST searches in Skatebase, a set of primers were designed to isolate the partial open reading frame (ORF) of LerLXR with Phusion Flash master mix (Thermo Fisher Scientific). The isolated partial ORF was further extended through rapid amplification of cDNA ends (RACE) technique. For this 5´ RACE ready cDNA was prepared from previously isolated RNA using the SMARTER RACE cDNA amplification kit (Clontech) according to manufactures recommendations. The full ORF of LerLXRα was amplified using Phusion Flash master mix (Thermo Fisher Scientific). For LXR isolation in amphioxus (KY094511), B. lanceolatum, adult specimens were collected from Ria Formosa, Portugal. Total RNA and cDNA synthesis were performed as described earlier. A combination of PCR strategies (e.g., degenerate primers, RACE PCR and genome database search) was employed to isolate the full ORF of the LXR orthologue.The ligand binding domain (LDB) including the hinge region of H. sapiens LXRβ (U07132.1), L. erinacea LXRα (Ler LXRα) and L. erinacea LXRβ (LerLXRβ) (transcriptome Contig89816 from Skatebase), L. japonicum LXR (LjaLXR) and B. lanceolatum LXR (BlaLXR) were isolated by PCR with Phusion Flash master mix (Thermo Fisher Scientific) using the specific primers (HsaLXRβ PF-ACTGGGATCCTAGATCCGGAAGAAGAAGATTCGG and PR-ATATCTAGATCACTCGTGGACGTCCCAGAT; LerLXRα PF-ACTGGGATCCGGAA GAAAATGAAGAAGCTGGAG and PR-ATATCTAGAAGTCATTCCTGCATGTCCCAG; LerLXRβ PF-ACTGGGATCCAGAAGAAGCAGAGGAAGCGGGAG and PR-ATATCTAG ACCCTCCGTCACTCATGCAC; LjaLXR PF-CCCTCTAGACGTCGGAAAAACGACGA ACC and PR-AAAGGTACCTCACTCGTGAACGTCCCAGA; BlaLXR PF-GCATCTAGA CTCCGCGACAGAGCACC and PR-CCGGGTACCCTACTGTGGAACGTCCCATAT). PCR reaction comprised an initial denaturation step at 98°C for 10 s followed by 40 cycles of denaturation at 98°C for 1 s annealing at 62°C (LerLXRs) or 60°C (LjaLXR and BlaLXR) for 5 s and extension at 72°C for 15 s, with an final extension step for 60 s. The resulting PCR products and pBIND (AF264722; Promega) were digested with BamHI and XbaI (LerLXRs) or XbaI and KpnI (LjaLXR and BlaLXR) restriction enzymes (Promega) and ligated withT4 ligase (Promega) to produce GAL4-LBD “chimeric” receptor. COS-1 cells were seeded into a 24-well plate at a concentration of 2×105 cells/ml 24 h prior to transfection. Cells were transfected with lipofectamine 2000 reagent (Invitrogen) and the transfection medium OptiMEM (Life Technologies) according manufacturer’s indications, using 500 ng of pBIND constructions and 1,000 ng of pGL4.31[luc2P/GAL4UAS/Hygro] vector (DQ487213; Promega). After 5 h of incubation, transfection media was replaced with phenol red-free DMEM (PAN-Biotech) supplemented with 10% of charcoal stripped fetal bovine serum (PAA Laboratories) and cells were treated with varying concentration of oxysterols (ranging from 101 to 105.5 nM) in DMSO. Cells were lysed 24 h after transfection and assayed for luciferase activity with Dual-Luciferase Reporter Assay System (Promega), according to the manufacturer’s instructions. All transfections were performed in triplicate. Data was presented as means± standard error (SE) from three separate experiments. SigmaPlot 11.0 software was used to calculate the EC50 values from the sigmoidal dose–response curves and the differences between groups variation were analysed with one-way ANOVA. Holm–Sidak was used to identify significant differences in the normalized-fold activation of the LXR receptors with the several compounds tested. The level of significance (P value) was set to 0.05.The synthetic LXR agonist T0901317 and 24(S)-hydroxycholesterol (24-HC) were obtained from Enzo, 25-hydroxycholesterol (25-HC) and 24(S),25-epoxycholesterol (24,25-EC) were obtained from Santa Cruz Biotechnology. All test compounds were diluted in DMSO in order to obtain the desired concentrations. […]

Pipeline specifications

Software tools MAFFT, Geneious, MrBayes, CIPRES Science Gateway, SigmaPlot
Applications Miscellaneous, Phylogenetics
Organisms Homo sapiens, Latimeria chalumnae
Chemicals Cholesterol