Computational protocol: No Evidence for Mutations of CTCFL/BORIS in Silver-Russell Syndrome Patients with IGF2/H19 Imprinting Control Region 1 Hypomethylation

Similar protocols

Protocol publication

[…] CTCFL genomic sequence was downloaded from NCBI Map Viewer and exons were demarcated using the NCBI cDNA sequence NM_080618.2. SNPs were identified using dbSNP and the ABI GeneAssist Genotyping Alignment Map (Applied Biosystems website). This map was then used to design intronic primers to individually amplify exons 2–11 and nested or partially nested primers sequencing primers to directly sequence the PCR products (). 5′UTR PCR primers were designed to encompass the entire 5′UTR as described by Renaud et al. 100 ng of genomic DNA was used in 50 µl PCR reactions for each exon in each patient using either AmpliTaq Gold (ABI, exons 2–11) or Phusion DNA Polymerase (Finnzymes, 5′UTR). PCR reaction conditions are available upon request. After purification with the QIAquick PCR Purification Kit (Qiagen), PCR products were sequenced and run on an ABI 3130xl DNA Fragment Analyzer. Chromatograms were manually inspected using FinchTV (Geospiza). [...] To analyze possible mis-splicng caused by novel SNPs in CTCFL we first used in silico methods to search for possible splice-altering SNPs. Two online programs, Flybase Splice Site Predictor (http://www.fruitfly.org:9005/seq_tools/splice.html) and ESE Finder 3.0 (http://rulai.cshl.edu/cgi-bin/tools/ESE3/esefinder.cgi) were used to analyze splice sites with or without the novel SNP and flanking sequence. To experimentally test for alternative splicing caused by novel SNPs we used a minigene splicing assay. 100 ng of patient or control DNA was used in PCR reactions with Phusion DNA polymerase to amplify the genomic region of CTCFL encompassing exons 2–5 (E2-5) using primers upstream of exon 2 (miniE2-5f: 5′- GCGGGATCCAGAGTGTGCTCAGGCGGAAC) and downstream of exon 5 (miniE2-5r: 5′- CGCACTAGTGTGAGTACCGCCAAACCTGTTAG). The PCR product was then digested with BamHI and SpeI, gel-purified, and cloned into pRHCglo . Individual colonies of DH10 transformed with pRHCglo E2-5 were picked, grown overnight and plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen). Plasmid DNA was sequenced to identify transformants of each allele. Next, 5 µg of pRHCglo E2-5 plasmid DNA was CaPO4-tranfected into 293T cells . Cells were grown overnight, the media was changed the next morning and cells were left to grow for a total of 48 hours. Total RNA was extracted using TRI-Reagent (Sigma) and reverse transcription and PCR were performed using the SuperScript III One-Step RT-PCR System (Invitrogen). The primer TNIE4 (5′-AGGTGCTGCCGCCGGGCGGTGGCTG) was used for reverse transcription as described by Singh and Cooper . PCR primers were designed and used to amplify the exon 2/3 boundary to evaluate splicing (splchkf: 5′- GTGTGGCCATTAGTATCCAG; splchkr: 5′- GCTGTAGGTTGATCCTCTTG). PCR products were then analyzed by agarose gel electrophoresis. […]

Pipeline specifications

Software tools Map Viewer, FinchTV, ESEfinder
Databases dbSNP FlyBase
Applications WGS analysis, Sanger sequencing
Organisms Homo sapiens, Mus musculus
Diseases Silver-Russell Syndrome