Computational protocol: Nucleospora cyclopteri n. sp., an intranuclear microsporidian infecting wild lumpfish, Cyclopterus lumpus L., in Icelandic waters

Similar protocols

Protocol publication

[…] Dissected ethanol-preserved kidney tissues from three fish suspected to be infected with the microsporidian, and the ten fish for microsporidian screening, were further cut with a scalpel blade and approximately 25 mg of tissue digested at 56°C in tissue lysis buffer containing 100 μg/mL proteinase K until dissolved. DNA was extracted using a GeneMATRIX DNA extraction kit (EURx Poland) following the tissue protocol and 10 ng used as template DNA for PCRs. Small subunit (SSU), internal transcribed spacer (ITS) and partial large subunit (LSU) regions of the rRNA gene were amplified using previously described microsporidian primers [,]. An additional primer 870fwd 5′ tgcggcttaatttgactcaac [] and its complementary reverse primer 870rev were used with the forward and reverse primers to allow a sufficient overlap for sequence confirmation. PCRs were performed according to the original descriptions with the use of suitable negative controls. PCR products were run alongside a 100 bp DNA ladder on 1% agarose gels, pre-stained with 1× SYBR®-safe (Invitrogen Oregon USA), and visualised with a high performance UV transilluminator (UVP, Cambridge UK). Direct sequencing reactions were done using BigDyeTM Terminator Cycle Sequencing chemistry utilising the same primers. DNA sequencing was performed in both directions on all positive PCR products, of the expected sizes, and compared to sequences available in the GenBank databases using nucleotide-nucleotide BLAST searches [] to verify a microsporidian origin. The contiguous sequence was obtained manually using CLUSTAL-X [] and BioEdit []. CLUSTAL X was used for the initial sequence alignments, with the settings for gap opening/extension penalties being adjusted manually to achieve optimum alignments, and manually edited using the BioEdit sequence alignment editor. Percentage divergence matrices were constructed in CLUSTAL X using the neighbour-joining method based on the Kimura 2-parameter model []. Microsporidia from the Enterocytozoonidae are typically assigned as new species or given generic status partly based on SSU rDNA sequence data []. Therefore, alignment files of 16 taxa, representative of microsporidia from the family Enterocytozoonidae and related basal taxa, consisting of 1,269 characters of SSU sequence data were used in the phylogenetic analyses.Phylogenetic analyses were performed using the maximum likelihood methodology in PhyML [] with the general time-reversible substitution model selected and 1000 bootstrap repeats, and Bayesian inference (BI) analysis using MrBayes v. 3.0 []. For the BI analysis, models of nucleotide substitution were first evaluated for the alignment using MrModeltest v. 2.2 []. The most parameter-rich evolutionary model based on the AIC was the general time-reversible, GTR + I + G model of evolution. Therefore, the settings used for the analysis were nst = 6, with the gamma-distributed rate variation across sites and a proportion of invariable sites (rates = invgamma). The priors on state frequency were left at the default setting (Prset statefreqpr = dirichlet (1, 1, 1, 1). Posterior probability distributions were generated using the Markov Chain Monte Carlo (MCMC) method with four chains being run simultaneously for 1000.000 generations. Burn in was set at 2.500 and trees were sampled every 100 generations making a total of 7.500 trees used to compile the majority rule consensus trees. […]

Pipeline specifications

Software tools Clustal W, BioEdit, PhyML, MrBayes, MrModelTest
Application Phylogenetics
Organisms Nitrosomonas sp.
Diseases Infection, Kidney Diseases, Kidney Papillary Necrosis