Computational protocol: A new alkalophilic isolate of Bacillus as a producer of cyclodextrin glycosyltransferase using cassava flour

Similar protocols

Protocol publication

[…] A pair of universal primers, 8F (5′ AGAGTT TGATCCTGGCTCAG 3′) and 1492R (5′ ACGGCTACCTTGTTACGACTT 3′) was used to amplify the 16S rRNA. The sequencing was carried out commercially by Macrogen Co. (Korea). The 16S rRNA sequence was used as query in BLASTN search against National Center for Biotechnology Information (NCBI) database. MEGA 5.05 software was used to construct an evolutionary model and to generate the maximum likelihood tree. The 16S rRNA sequences used in the phylogenetic analysis were retrieved from the site of List of Prokaryotic Standing Names (LPSN) during August, 2014. […]

Pipeline specifications

Software tools BLASTN, MEGA
Databases LPSN
Application Phylogenetics
Organisms Manihot esculenta, Hemisus marmoratus, Zea mays subsp. mays
Chemicals Carbohydrates, Edetic Acid, Magnesium, Potassium, Sodium