Computational protocol: Virus-Bacteria Rice Co-Infection in Africa: Field Estimation, Reciprocal Effects, Molecular Mechanisms, and Evolutionary Implications

Similar protocols

Protocol publication

[…] Two spatial scales were considered for the sampling and selection of viral isolates and bacterial strains. At the continental scale (Africa), we used viral isolates and bacterial strains collected in previous studies and originating from three countries: (1) Burkina Faso BF1 (Pinel et al., ) and BAI13 (Wonni et al., ), (2) Tanzania Tz11 (Fargette et al., ) and TAI2 (Poulin and Szurek, unpublished), and (3) Madagascar Mg1 (Pinel et al., ) and MdAI1 (Poulin et al., ), for RYMV and Xoc respectively.At the local scale, we visited rice fields on October 5-6 2014 in Southwestern Burkina Faso. Both RYMV and BLS symptoms were found in the same fields in three localities: irrigated perimeters of Banzon (GPS: N 11.31955; 04.80978) and Karfiguela (GPS: N 10.68347; W 04.81605), and in a rainfed farmer's field in Karankasso Sambla (GPS: N 11.24732; W 04.56256). Viral isolates obtained were named respectively: BF705 from Banzon, BF706 from Karankasso Sambla and finally BF707 from Karfiguela.Virus-infected rice leaves have been collected and dried in plastic bags containing silica gel. RYMV-specific ELISA diagnostic test was performed as previously described (Traoré et al., ) and confirmed the visual diagnostic of RYMV. Genetic characterization of collected samples was performed though sequencing of the CP region as described previously (Pinel et al., ). Briefly, the samples were first submitted to RNA extraction (using RNeasy Mini Kit, Qiagen), reverse transcription (using the following primer RYMV II: CTCCCCCACCCATCCCGAGAATT), amplification (using RYMV II and RYMV III: CAAAGATGGCCAGGAA) and sequencing of CP region. The CP sequences from the 3 isolates tested in this study and a set of 300 CP sequences from 17 African countries representing the RYMV genetic diversity (Pinel-Galzi et al., ) were aligned using CLUSTAL X with default parameters (Thompson et al., ). A model selection procedure accessed through MEGA6 (Tamura et al., ) was run to select the best fitted model of nucleotide substitution. The Kimura-2 model with a rate variation and an invariant rate class (K2+G+I) provided the best fit. The maximum-likelihood phylogenetic tree was inferred using MEGA6.BLS-infected rice leaves were sampled and kept in a cold box until freezing. Bacterial isolation was performed at 28°C on PSA medium with antibiotics (actidione 50 mg/L; cephalexin 40 mg/L; kasugamycin 20 mg/L). Isolated bacterial strains obtained were preserved in PSA-glycerol medium for long-term storage at −80°C. They were named BAI118 (from Banzon), BAI119 (from Karfiguela) and BAI120 (from Karankasso Sambla). […]

Pipeline specifications

Software tools Clustal W, MEGA
Application Phylogenetics
Organisms Oryza sativa, Rice yellow mottle virus, Xanthomonas oryzae
Diseases Coinfection