Computational protocol: Molecular characterization of endophytic fungi associated with the roots of Chenopodium quinoa inhabiting the Atacama Desert, Chile

Similar protocols

Protocol publication

[…] Genomic DNA was extracted from the mycelial mat of 45 pure isolates using the method described by Nicholson with slight modifications. Species identification of endophytic fungi was performed using the primers ITS1-F-KYO1 (CTHGGTCATTTAGAGGAASTAA) and ITS4 (TCCTCCGCTTATTGATATGC). Amplification of the ITS regions (around 680 kbp) was conducted with 50 mL of PCR reaction mixtures, each containing 7 μL of total fungal genomic DNA, 1 μL of each primer (10 μM), 27.5 μL of SapphireAmp Fast PCR Master Mix (Takara) and 13.5 μL of sterilized water. PCR was performed in a Techne TC-5000 Thermal Cycler (Fisher Scientific) with the following program: 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 30 s and primer extension at 72 °C for 1 min, completed with a final extension at 72 °C for 7 min. PCR products were sent to Macrogen (South Korea) for purification and sequencing. Sequences were assembled using SeqTrace software. Consensus sequences were used for BLAST search at the NCBI (http://www.ncbi.nlm.nih.gov).Sequences alignments and phylogenetic tree were constructed by using MEGA software, version 7.0 . Alignments were performed with ClustalW , DNA weight matrix ClustaW 1.6 and default parameters. Phylogenetic reconstruction was performed by using neighbor-joining method , with p-distance substitution model and bootstrapping of 1000. Additional 18S rRNA sequences for the different genera were retrieved from NCBI. […]

Pipeline specifications

Software tools SeqTrace, MEGA, Clustal W
Applications Phylogenetics, Sanger sequencing