Computational protocol: Identification and characterization of endophytic bacteria from corn (Zea mays L.) roots with biotechnological potential in agriculture

Similar protocols

Protocol publication

[…] For the second PCR reaction, the following primers, designed by Prof. Leonardo M. Cruz (Dept. Biochemistry, Federal University of Paraná, Curitiba, PR, Brazil), were used: 362f (5′ CTCCTACGGGAGGCAGCAGTGGGG 3′), 786f (5′ CGAAAGCGTGGGGAGCAAACAGG 3′), in addition to the fD1 primer (Weisburg et al. []). Eighty ng of the purified product from the first PCR reaction, 0.25 mM of primer and 2 μL ET mixture were used for sequencing. Ultrapure water was added to reach the final volume of 10 μL. Amplification was performed for 35 cycles of 30 s at 94°C, 15 s at 50°C and 90 s at 60°C.After amplification, purification was performed with Sephadex™ filtration gel, G-50 medium (GE® Healthcare) and then the product was submitted to electrophoresis with an automated DNA sequencing analyser, model MegaBACE1000 (Amersham Biosciences®).The quality of the bases and the fragment assembly were analyzed with the PhredPhrapConsed software (Ewing et al. []). Alignments were carried out with the PRANK software (Löytynoja and Goldman []). The percentage of similarity was obtained from the RDP (Ribosomal Database Project).The phylogenetic analysis was made using Bayesian inference with the MrBayes 3.1.2 software (Ronquist and Huelsenbeck []) using parallel computing (Altekar []), with four chains. The evolutionary model was selected through the JModelTest program (Posada and Kandral []). The number of generations and “burn-in” were defined by analysis of multiple sequences, with topological stability assessment by the AWTY package (Nylander et al. []) and analyzed by the parametric stability software, Tracer 1.5. With appropriate values of “burn-in”, the final trees were summarized with the software package SumTrees DendroPy 3.8.1 (Sukumaran and Holder []). […]

Pipeline specifications

Software tools PRANK, MrBayes, jModelTest, AWTY, DendroPy
Application Phylogenetics
Organisms Zea mays subsp. mays, Zea mays, Fusarium verticillioides, Colletotrichum graminicola, Bipolaris maydis
Diseases Callosities
Chemicals Acetylene, Nitrogen