Computational protocol: Early life antibiotic exposure affects pancreatic islet development and metabolic regulation

Similar protocols

Protocol publication

[…] Total DNA from fecal samples and ileal and distal colon contents was extracted with the QIAamp DNA Mini Stool Kit (Qiagen, Inc. Mississauga, ON, Canada) following the manufacturer’s instructions, with the addition of a bead beating step (FastPrep instrument, MP Biomedicals, Solon, OH). DNA concentrations and quality were determined by a NanoDrop 2000c. Extracted DNA was diluted to 20 ng/μl for PCR amplification.The hypervariable regions (V1 to V3) of the bacterial 16 S rRNA gene were amplified with nucleotide barcoded primer pairs 27 F: 5′-AGAGTTTGATCMTGGCTCAG-3′ and 519 R: 5′-GWATTACCGCGGCKGCTG-3′. The forward primer contained Roche/454 Titanium adaptor A (CCATCTCATCCCTGCGTGTCTCCGACTCAG) and unique 10-bp barcodes, and the reverse primer contained adaptor B (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG). The PCR was performed on an S1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA) using the following parameters: initial denaturation at 98 °C for 1 min, followed by 35 cycles of 98 °C for 10 s, 59 °C for 30 s and 72 °C for 30 s, with a final extension at 72 °C for 7 min. Then triplicate DNA amplification products were mixed and gel-purified (QIAquick gel extraction kit, Qiagen, Valencia, CA). Each amplicon (100 ng) was pooled and pyrosequenced using a 454 Titanium platform (Roche, Branford, CT).Sequence data that passed Roche’s quality thresholds were processed according to the mothur 454 SOP accessed on June 16, 2015. Barcodes were trimmed and quality sequences were obtained by removing sequences containing ambiguous bases and quality read length < 200 bases. Sequences passing quality filter were aligned to the silva bacterial reference alignment. Sequences were clustered based upon 0.97 similarity using UClust into operational taxonomic units (OTUs) and hypothesis testing were performed with normalized data in mothur. Differences in overall community were tested by multivariate analysis of variance (MANOVA) with Bonferroni correction for multiple comparisons. Abundance of bacterial OTUs to phyla was compared using the Mann-Whitney U-test or student’s T-test. Inverse Simpson diversity index was used to ascertain differences in alpha diversity based on antibiotic exposure status. Weighted UniFrac distance matrices were calculated for beta diversity analyses. […]

Pipeline specifications

Software tools mothur, UCLUST, UniFrac
Application 16S rRNA-seq analysis
Organisms Sus scrofa, Homo sapiens
Diseases Metabolic Diseases
Chemicals Glucose